evolutionary optimization in the design of a heat sink

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

... signal or the output of an actual switch Such signals can be used to label the brain signals and to evaluate the performance of a BI The data analysis of individuals with motor disabilities was ... discard the least informative features based on the amount of information that each feature carries regarding the output classes presence of feature i and a value of "0" indicated its absence in ... over an interval containing the movement onset (measured as the finger switch activation) if no artifact was detected in that particular interval The interval starts at tstart seconds before Page...

Ngày tải lên: 19/06/2014, 10:20

13 530 0
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot

... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in the ... parity generating function to provide one set of parity values The k is the basic block size of the input data, and n is the block size of the output data, new data samples are accepted and (n - ... syndromes and comparing against thresholds five times the standard deviation of syndrome values when only low levels of round-off error appear The simulation program randomly selects the line in a magnitude...

Ngày tải lên: 20/06/2014, 22:20

12 574 0
Báo cáo y học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" pps

Báo cáo y học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" pps

... whether included studies had used a theory to inform the design of an intervention and/or the interpretation of the results A study was considered to have used a theory if the authors stated that ... N: Changing the behavior of healthcare professionals: the use of theory in promoting the uptake of research findings J Clin Epidemiol 2005, 58:107-112 Grimshaw JM, Thomas RE, Maclennan G, Fraser ... Strain R, et al: A randomized controlled trial of quality assurance in sixteen ambulatory care practices Medical Care 1985, 23:751-770 51 Putnam R, Curry L: Impact of patient care appraisal on...

Ngày tải lên: 11/08/2014, 05:21

6 411 0
báo cáo khoa học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" ppt

báo cáo khoa học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" ppt

... whether included studies had used a theory to inform the design of an intervention and/or the interpretation of the results A study was considered to have used a theory if the authors stated that ... N: Changing the behavior of healthcare professionals: the use of theory in promoting the uptake of research findings J Clin Epidemiol 2005, 58:107-112 Grimshaw JM, Thomas RE, Maclennan G, Fraser ... Strain R, et al: A randomized controlled trial of quality assurance in sixteen ambulatory care practices Medical Care 1985, 23:751-770 51 Putnam R, Curry L: Impact of patient care appraisal on...

Ngày tải lên: 11/08/2014, 16:20

6 429 0
Báo cáo y học: "Arterial pressure optimization in the treatment of septic shock: a complex puzzle" pot

Báo cáo y học: "Arterial pressure optimization in the treatment of septic shock: a complex puzzle" pot

... require an experimental design that allowed testing of cause and effect rather than an analysis of association In our opinion, a more likely reason for the association between higher vasopressor ... while assuring that additional volume infusion – or, in some patients, inotropic therapy – will allow reduction of vasopressor therapy There are many factors about the cardiovascular support of ... factors are probably extremely important in determining patient response Pre-existing disease, intact autoregulation and distribution of flow, among other factors, all play a role in the optimal...

Ngày tải lên: 13/08/2014, 20:21

2 248 0
Báo cáo y học: "Delta inflation: a bias in the design of randomized controlled trials in critical care medicine" ppsx

Báo cáo y học: "Delta inflation: a bias in the design of randomized controlled trials in critical care medicine" ppsx

... data We abstracted data from the results of the trial including the number of patients in the treatment and placebo arms that were included in the final data analysis, and the mortality rate in ... (81.6%) of the trials had an associated 95% confidence interval that included a delta of 3%, which was the smallest predicted delta sought by investigators in all of the trials [18] Among all trials, ... reported and the authors could not provide the information The remaining 38 articles were included in our analysis Additional file shows the characteristics of the included trials Among all trials,...

Ngày tải lên: 13/08/2014, 20:22

7 312 0
Báo cáo y học: " Elevation of cardiac troponin I during non-exertional heat-related illnesses in the context of a heatwave" doc

Báo cáo y học: " Elevation of cardiac troponin I during non-exertional heat-related illnesses in the context of a heatwave" doc

... biological data YLM participated in statistical analysis BR participated in the conception and design of the study, statistical analysis and interpretation of data, and in drafting the manuscript Acknowledgements ... pointed out that a high heart rate indicates a considerable heart strain in the clinical conditions of heatstroke and that an elevated serum creatinine level might reflect global dehydration The ... was considered as indicating myocardial damage A value >1.5 ng.L-1 was considered as indicating severe myocardial damage, as previously reported [18] Statistical analysis Data are expressed as...

Ngày tải lên: 13/08/2014, 20:22

9 298 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... when the data manager relinquishes that memory If the data manager does not process and release the data within an adequate period of time, the data may then be paged out to the default pager In ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

... sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in ... MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income ... limited by all the MFIs operating in Pakistan The average loan size in Pakistan is ranging from 10,000- 15,000 only Keeping in mind the inflation and ever increasing price in Pakistan, the loan size...

Ngày tải lên: 06/09/2013, 05:48

23 553 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly ... expectations and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... ABSTRACT There is a lack of research that focuses on the suitability of the concept of customer satisfaction and the current methods used for measuring it in organizations operating in business-to-business...

Ngày tải lên: 15/01/2014, 15:59

37 1,1K 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... (a) In the absence of one or more integral membrane subunits the majority of the subunits in the peripheral-subcomplex are accumulated in a stable form, and most likely already associated in a ... of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant number of differences in the N-terminal ... Each of the mutants was found to have a premature chain-termination codon within the open reading frame In two of the mutants (CCL16-B11 and V79-G18) the predicted protein is truncated at a position...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc

Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc

... a publisher, a root of a multicast tree, a subscriber to a topic, a node within a multicast tree, and any sensible combination of the above Much of the scalability and reliability of Scribe and ... node (according to a scalar proximity metric, such as the delay or the number of IP routing hops) is chosen in practice In addition to the routing table, each node maintains IP addresses for the ... metric is a scalar value that reflects the “distance” between any pair of nodes, such as the number of IP routing hops, geographic distance, delay, or a combination thereof It is assumed that a function...

Ngày tải lên: 19/02/2014, 18:20

13 631 0
Tài liệu In the Shadows of a Fallen Wall docx

Tài liệu In the Shadows of a Fallen Wall docx

... memories are of viewing seminal national events: the first moon landing, the Viet24 BUT FOR THE WEATHER nam War, and the Watergate hearings While the moon landing produced the sort of cheering and ... mother -in- law, Karin’s — then passed through the second floor of the house next door and landed in the third, killing the family hiding in the basement Karin’s family, having taken cover in their ... incursions, a corridor with watchdogs, and tripwires attached to machine guns The final barrier always consisted of the Mauer feindwärts, the “wall facing the enemy.” The view of the Wall from East and...

Ngày tải lên: 22/02/2014, 06:20

208 481 0
Incidents in the Life of a Slave Girl Written pdf

Incidents in the Life of a Slave Girl Written pdf

... unhappiness, was the fact that my brother William was purchased by the same family My father, by his nature, as well as by the habit of transacting business as a skillful mechanic, had more of the ... that I did not live on a distant plantation, but in a town not so large that the inhabitants were ignorant of each other's affairs Bad as are the laws and customs in a slaveholding community, the ... coursing in the veins of American slaves? I have spoken of the pains slaveholders take to give their slaves a bad opinion of the north; but, notwithstanding this, intelligent slaves are aware that...

Ngày tải lên: 15/03/2014, 03:20

196 463 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...

Ngày tải lên: 16/03/2014, 23:20

11 585 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

... homogenates of male and female antennae contained an immunoreactive band with an apparent molecular mass of 40 kDa (Fig 1, left, A, B) In the sample of primary cell culture of M brassicae, a band ... sequence analysis revealed that the cDNA contains a putative coding region of 1059 bp, encoding a 353 amino-acid protein with a theoretical molecular mass of 41 400 Da and an isoelectric point of 5.35, ... hairs are distributed in two classes according to their length The long ones (long sensilla trichodea) are located on the lateral part of the ventral area and are arrayed in four to five parallel...

Ngày tải lên: 17/03/2014, 23:20

10 619 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

... indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence or presence of p-amindinobenzamidine (A) Effect of trypsinogen ... Trypsin catalyzes the activation of trypsinogen in an intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal of the N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys ... period, a rapid increase in trypsin activity was observed The lag phase of the S-shaped activation curve is shortened by an increase in the trypsinogen concentration, and the maximal trypsin activity...

Ngày tải lên: 23/03/2014, 13:20

8 403 0
Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... Harper Parsec: An architecture for parallel parsing of constraint dependency grammars In Submitted to The Proceedings o /the ~9th Annual Meeting o.f ACL, June 1991 [3] H Maruyama Constraint dependency...

Ngày tải lên: 23/03/2014, 20:20

2 359 0
w