evolution of a big idea

The making of a big idea: Short guide to make an Application

The making of a big idea: Short guide to make an Application

Ngày tải lên : 10/07/2014, 14:18
... mb ro ee ’ s a A ETR EL BTE WHE ? b t lase mb r n akitee u a y rme e a d s, h r w s RSA C EER H s rwt ail bt f t t i lt io a h te PA LN n x s p maea e tt k e WHT O O NE? A D YU ED ak o r l s ... O ITG AIN DPOM N NERT & ELY ET O WH D YU ED O O O NE? a dte ,h k b u n h n ti a o t n AO E LN w cn a as oi e a l y d t tw Ou Ta r e m: Ae l x DSG G Y EIN U Dn a CO E DVLPR LST EE E O Mat rn ... s B A DN & RAIE TAEY R N IG C ET SRTG V IFR AIN R HTCU E NO M T A C I TR O E VS A UDSG IU L IEIN FO T N DVLP ET R N- D EE M N E O TC NC L EER H EPO AIN EH IA RSA C & XLRT O B C - D EE P ET A KE...
  • 38
  • 377
  • 0
Tài liệu FINANCIAL ENGINEERING The Evolution of a Profession pptx

Tài liệu FINANCIAL ENGINEERING The Evolution of a Profession pptx

Ngày tải lên : 18/02/2014, 18:20
... state of financial research and practice in a particular area of finance The essays in each volume are intended for practicing finance professionals, graduate students, and advanced undergraduate ... students The goal of each volume is to encapsulate the current state of knowledge in a particular area of finance so that the reader can quickly achieve a mastery of that special area P1: OTA/XYZ JWBT449-fm ... of financial firms was continuous and done at a manageable pace But the period was also one of frequent violent upheaval, as wars repeatedly ravaged nations and populations New firms were born and...
  • 615
  • 735
  • 0
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc

Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc

Ngày tải lên : 23/03/2014, 06:20
... Continuous HAT assay Progress curves as a measure of HAT activity of wild-type and mutant P ⁄ CAFs were followed using a coupled enzyme assay [62] HAT activity generates CoA as a byproduct that is ... catalytic domain of the human HAT P ⁄ CAF, without affecting its catalytic activity or substrate specificity P ⁄ CAF, p300 ⁄ CBP-associating factor, is a trans criptional coactivator with a variable N-terminal, ... 1–7 24 Yanase M, Takata H, Fujii K, Takaha T & Kuriki T (2005) Cumulative effect of amino acid replacements results in enhanced thermostability of potato type L alpha-glucan phosphorylase Appl Environ...
  • 13
  • 226
  • 0
Evolution of a Prototype Financial Privacy Notice: A Report on the Form Development Project pptx

Evolution of a Prototype Financial Privacy Notice: A Report on the Form Development Project pptx

Ngày tải lên : 29/03/2014, 18:20
... coded and entered into a database using Atlas.ti, a qualitative research software package In our analysis, we examined and used the data collected from each round of testing to revise and refine ... of analyzing data at certain times and with different research analysts Field analysis recorded immediate observations of the moderator, notetaker, and observer Content analysis of the notetaker’s ... privacy laws and financial institutions’ sharing practices in a factual and neutral way The language could and should not direct a consumer to make any particular decision Through the course of...
  • 337
  • 350
  • 0
Báo cáo khoa học: Directed evolution of a glutaryl acylase into an adipyl acylase potx

Báo cáo khoa học: Directed evolution of a glutaryl acylase into an adipyl acylase potx

Ngày tải lên : 31/03/2014, 09:20
... both substrate and sample and compared to a calibration curve of 7-ACA or 7-ADCA, respectively 1.2 mM Glutaryl-7-ACA was used as substrate for the analysis of fractions during the purification For ... [31,32], and is absent in the mature protein Removal of the spacer peptide of 10 amino acids leaves a catalytically active enzyme consisting of an a- subunit of 161 amino acids weighing 17.7 kDa and a ... cephalosporin acylase gene of a Pseudomonas strain Biochim Biophys Acta 1132, 233–239 15 Matsuda, A. , Matsuyama, K., Yamamoto, K., Ichikawa, S & Komatsu, K (1987) Cloning and characterization of the...
  • 10
  • 447
  • 0
the symbian os architecture sourcebook design and evolution of a mobile phone os

the symbian os architecture sourcebook design and evolution of a mobile phone os

Ngày tải lên : 01/06/2014, 11:21
... Communicator was classified by market analysts as a PDA, partly because it had a keyboard, but also partly because Symbian phones really were a new category, and analysts didn’t quite know what to ... Protea project, one which caused a succession of headaches for Geert Bollen, was the lack of real hardware Software development started well ahead of the availability of any prototype hardware ... Protea project began Planning for a design life of at least as many years for the new operating system was a matter of basic commercial common sense It is likely that, had Psion had been a pure software...
  • 633
  • 405
  • 0
Comparative genome and phenotypic analysis of Clostridium difficile 027 strains provides insight into the evolution of a hypervirulent bacterium" ppsx

Comparative genome and phenotypic analysis of Clostridium difficile 027 strains provides insight into the evolution of a hypervirulent bacterium" ppsx

Ngày tải lên : 09/08/2014, 20:20
... only patients on antimicrobial and other therapies that can alter the balance of the gut microbiota (for example, antacid/proton pump inhibitors and non-steroidal anti-inflammatory drugs), but also ... washes and chloroform:IAA (Sigma-Aldrich) washes Genomic DNA was precipitated using 100% ethanol and purified with two washes of 80% ethanol Purity was assessed and quantification done using a Genome ... manuscript Additional data files The following additional data are available with the online version of this paper: CDSs specific to PCR-ribotype 027 isolates (Additional data file 1); CDSs that have...
  • 15
  • 282
  • 0
Báo cáo y học: "The role of emergency medicine physicians in trauma care in North America: evolution of a specialty" pps

Báo cáo y học: "The role of emergency medicine physicians in trauma care in North America: evolution of a specialty" pps

Ngày tải lên : 13/08/2014, 23:20
... trauma only as part of their general EM training, particularly if a separate trauma team responds for trauma activations In smaller North American hospitals that are not designated as trauma ... Accreditation Guidelines Toronto, Canada: Trauma Association of Canada; 2003 Ahmed JM, Tallon JM, Petrie DA: Trauma management outcomes associated with nonsurgeon versus surgeon trauma team leaders Ann ... initial resuscitative care and transport the patient to a trauma center EMP's therefore may play a significant role in the initial phase of trauma care as part of their overall work flow in many...
  • 6
  • 316
  • 0
earth evolution of a habitable world

earth evolution of a habitable world

Ngày tải lên : 09/01/2015, 15:06
... Significant distances Diameter of universe Distance to nearest galaxy like ours Diameter of our galaxy Alpha Centauri Distance to nearest star Sun Diameter of solar system Pluto Astronomical unit Earth ... of different stars However, various tricks can be used that take advantage of observations of closer-in galaxies Spiral galaxies, so named because the stars trace out a distinctive spiral shape ... sampling by spacecraft of the solar wind (a stream of charged atoms emanating from the Sun) and material from dust emitted by comets, and chemical analysis of a class of meteorites (rocks that...
  • 344
  • 696
  • 0
Building the tree of life reconstructing the evolution of a recent and megadiverse branch (calyptrates  diptera)

Building the tree of life reconstructing the evolution of a recent and megadiverse branch (calyptrates diptera)

Ngày tải lên : 12/09/2015, 09:21
... Sensitivity analysis, molecular systematics, and natural history evolution of Scathophagidae (Diptera:Calyptrate: Musocidea) Chapter 3: The Muscoidea (Diptera:Calyptratae) are paraphyletic: Evidence ... remains only poorly supported and the Bayesian analysis finds a similar placement of Hippoboscoidea as found by Nirmala et al (2001) and Dittmar et al (2006) in their parsimony and Bayesian analyses ... Yuchen, Farhan, Danwei, Denise, Dave, Nanthinee, Zeehan, Martin, Mirza, WaiKit and Huifung Thanks Anu, Aparna, Nilofer and Rika for all the fun times, get-togethers and of course the brilliant dance...
  • 201
  • 361
  • 0
Untethered employees the evolution of a wireless workplace

Untethered employees the evolution of a wireless workplace

Ngày tải lên : 04/12/2015, 00:19
... Singapore, Switzerland Healthcare, pharmaceuticals and biotechnology Brazil, China, Germany, Italy, Malaysia, New Zealand, Nigeria, Spain Manufacturing Belgium, Bulgaria, Czech Republic, Denmark, ... we facilitate that, the happier our members are Happier employees just mean a better company That’s where the magic happens—where people are happy to hang out together as part of what they call ... Latin America Agriculture and agribusiness Eastern Europe Automotive Africa Construction and real estate 2 Middle East Logistics and distribution 2 Retailing Transportation, travel and tourism What...
  • 14
  • 165
  • 0
Adaptive evolution of a duplicated pancreatic ribonuclease gene in a leafeating monkey

Adaptive evolution of a duplicated pancreatic ribonuclease gene in a leafeating monkey

Ngày tải lên : 27/05/2016, 21:11
... relationships among RNASE1 and RNASE1B of primates a, The gene tree of RNASE1 and RNASE1B Kimura’s two-parameter distances are used Virtually identical trees are obtained when Tajima-Nei, Tamura-Nei or TamuraNei-γ ... Enzyme activities of recombinant RNASE1B, RNASE1 and mutant forms of RNASE1 a, RNase activity against yeast tRNA at different pH levels b, RNase activity against dsRNA Mutant forms of douc langur ... leucogenys), douc langur (Pygathrix nemaeus), rhesus monkey (Macaca mulatta), pig-tailed macaque (Macaca nemestrina), baboon (Papio hamadryas), green monkey (Cercopithecus aethiops), talapoin monkey...
  • 6
  • 126
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Ngày tải lên : 18/02/2014, 17:20
... Hirata T, Nakamura N, Omote H, Wada Y & Futai M (2000) Regulation and reversibility of vacuolar H+ATPase J Biol Chem 275, 386–389 Tsunoda SP, Aggeler R, Yoshida M & Capaldi RA (2001) Rotation of ... 669–677 Sambongi Y, Iko Y, Tanabe M, Omote H, IwamotoKihara A, Ueda I, Yanagida T, Wada Y & Futai M (1999) Mechanical rotation of the c subunit oligomer in ATP synthase (F0F1): direct observation ... 1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids Inc., Alabaster, AL, USA) at lipid-toprotein ratios of 0.5, 1.0 and 1.5 w ⁄ w The mixture was dialyzed in 50 lL buttons (Hampton Research, Aliso Viejo, CA, USA) against...
  • 9
  • 773
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21
... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... PsbV and PsbU from a red alga, C caldarium, and PsbU from a cyanobacterium, T vulcanus and PsbQ from a green alga, C reinhardtii, were cloned and sequenced by means of PCR and a rapid amplification ... were also found in all cyanobacteria and green oxyphotobacteria analyzed (d) PsbQ is present in green algae and higher plants, and psbQ-like genes were found in most of cyanobacteria and a red alga...
  • 11
  • 501
  • 0
nanotechnology. a gentle introduction to the next big idea, 2002, p.153

nanotechnology. a gentle introduction to the next big idea, 2002, p.153

Ngày tải lên : 04/06/2014, 15:19
... and mathematics Chapter is a quick grand tour of some of the thematic areas of nanotechnology, via visits to laboratories Chapters to are the heart of the book They deal with the topical areas ... such as the nanoscale abacus that we saw in Chapter It takes a great deal of enhancement just to make the raw results look as good as the ghostly x-ray pictures taken of your luggage at the airport ... kind of nanofabrication, or nanoscale manufacturing Starting with a suitcase-sized chunk of gold, our successive cutting has brought it down to the nanoscale This particular kind of nanofabrication...
  • 153
  • 551
  • 0
temple univ pr food and evolution toward a theory of human food habits jan 1987

temple univ pr food and evolution toward a theory of human food habits jan 1987

Ngày tải lên : 11/06/2014, 16:29
... Bangladesh (Lindenbaum), Amazonia (Johnson and Baksh, Good, Ross), Paraguay (Hawkes), Canadian sub-arctic (Winterhalder), Southeast Asia and Africa (Franke), Mexico (Pelto), Costa Rica (Edelman), ... influence has worked in a diversity of ways, as the Achuara case suggests The Achuara today tend to regard such animals as tapir, deer, 14 Overview of Trends in Dietary Variation and capybara as inedible ... excluded from our attempt to understand general as well as particular aspects of the evolution of foodways Indeed, in a small number of cases such as that of fava bean (see Chapter 5) and milk consumption,...
  • 645
  • 298
  • 0
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Ngày tải lên : 18/06/2014, 22:20
... KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC ... GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACMZV) and South African cassava...
  • 23
  • 612
  • 0
Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx

Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx

Ngày tải lên : 20/06/2014, 01:20
... distances of H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and ... was extracted from 140 µl of human nasal swab suspension or nasopharyngeal aspirate by QIAamp® Viral RNA Mini Kit (QIAGEN, Germany) as described by the manufacturer or by an automated MagNA Pure ... total of 234 Danish human nasal swab suspensions or nasopharyngeal aspirates positive for influenza A, from 1999 to 2006, were available at the WHO National Influenza Centre, Copenhagen The seasonal...
  • 19
  • 579
  • 0
Báo cáo hóa học: " Experimental observations of rapid Maize streak virus evolution reveal a strand-specific nucleotide substitution bias" potx

Báo cáo hóa học: " Experimental observations of rapid Maize streak virus evolution reveal a strand-specific nucleotide substitution bias" potx

Ngày tải lên : 20/06/2014, 01:20
... the evolution rates of ssDNA and dsDNA viruses, proof of this may ultimately require a detailed comparative analysis of the individual impacts of all mutagenic reactions and repair pathways acting ... direct estimates of the basal or biochemical rates at which mutations occur during each replication cycle of ssDNA bacteriophages have also indicated that these rates approach those of RNA viruses ... increased C and G deamination rates As deamination rates are probably higher for ssDNA, this was taken to imply that high begomovirus mutation rates might be at least partially attributable to the...
  • 11
  • 308
  • 0