Blackwell Publishing Ltd Gregariousness and protandry promote reproductive insurance in the invasive gastropod Crepidula fornicata: evidence from assignment of larval paternity potx

Blackwell Publishing Ltd Gregariousness and protandry promote reproductive insurance in the invasive gastropod Crepidula fornicata: evidence from assignment of larval paternity potx

Ngày tải lên : 22/03/2014, 12:20
... relation between paternity status and size of individuals at the population level was investigated using a mixed-model anova, with the paternity status (father vs not father) and the population ... sex-reversal strategies? The inferred mating patterns are discussed in light of the individual features (size, position and sex at the time of sampling) of the assigned fathers and the population characteristics ... analyses at the population level Percentage of brooding females (calculated over the total number of females) and female : male ratio were estimated for each population Departure from a : sex ratio...
  • 13
  • 337
  • 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

Ngày tải lên : 20/06/2014, 04:20
... accrue at an accelerating rate, with the database currently receiving approximately a quarter of a million reports per quarter Data from 2008 reveal that of these, 152,017 incidents (15.5%) related ... notation of surgical site on consent form, participation of the surgeon in preoperative verification and participation of all surgical team members in formal time-out procedures [28] One of the ... systems that reliably deliver what is required and that identify errors that occur with built in mitigation steps that prevent errors causing harm Central to the success of such initiatives has...
  • 7
  • 443
  • 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf

Ngày tải lên : 20/06/2014, 07:20
... accrue at an accelerating rate, with the database currently receiving approximately a quarter of a million reports per quarter Data from 2008 reveal that of these, 152,017 incidents (15.5%) related ... notation of surgical site on consent form, participation of the surgeon in preoperative verification and participation of all surgical team members in formal time-out procedures [28] One of the ... systems that reliably deliver what is required and that identify errors that occur with built in mitigation steps that prevent errors causing harm Central to the success of such initiatives has...
  • 7
  • 507
  • 0
Báo cáo khoa học: "A Toxicity of polymyxins: a systematic review of the evidence from old and recent studies" ppsx

Báo cáo khoa học: "A Toxicity of polymyxins: a systematic review of the evidence from old and recent studies" ppsx

Ngày tải lên : 12/08/2014, 23:21
... is similar to that of the investigators of the previous studies [35,38] Methods Data for this review were obtained through literature searches of publications included in PubMed from 1950 until ... suggested that the amount of drug that is removed from blood by these two methods is relatively small [44,45] Patients that underwent peritoneal dialysis lost approximately mg of colistimethate sodium ... http://ccforum.com/content/10/1/R27 Treatment Mild neurological manifestations of polymyxins usually subside after prompt cessation of the drugs In the presence of neuromuscular blockade, immediate discontinuation of polymyxins...
  • 13
  • 345
  • 0
Tài liệu Báo cáo " Late Eocene metamorphism and ductile deformation age of Con Voi range, the Red River shear zone: evidence from the garnet Sm/Nd dating" docx

Tài liệu Báo cáo " Late Eocene metamorphism and ductile deformation age of Con Voi range, the Red River shear zone: evidence from the garnet Sm/Nd dating" docx

Ngày tải lên : 13/02/2014, 12:20
... variation of foliation dip angle, the lineation was constantly orientated in NW-SE direction with the plunge varied from to 20o All kinematic indicators indicated predominantly sinistral shear sense at ... foliation delineated by alternation of rich felsic and dark minerals layers Structural observations realized through the whole range along different cross sections indicated that the foliation ... ductile deformation of paragneiss coincided with garnet closure temperature so that the age of 35.6 m.y recorded timing of metamorphic culmination This new result, together with previous data [2, 6,...
  • 7
  • 475
  • 0
Tài liệu Informational efficiency of loans versus bonds: Evidence from secondary market prices pptx

Tài liệu Informational efficiency of loans versus bonds: Evidence from secondary market prices pptx

Ngày tải lên : 16/02/2014, 02:20
... (intraday) data, that the informational efficiency of corporate bonds is similar to that of the underlying stocks.1 However, there is no study to date that examines the informational efficiency of the ... maturity (in years) of the loan and that of the bond, as on a event date DLN(AMOUNT) stands for the difference in natural log of one plus the amount of the loan issue (in $ millions) and that of ... maturity (in years) of the loan and that of the bond, as on a event date DLN(AMOUNT) stands for the difference in natural log of one plus the amount of the loan issue (in $ millions) and that of...
  • 45
  • 322
  • 0
Tài liệu Dissecting the Eect of Credit Supply on Trade: Evidence from Matched Credit-Export Data  pdf

Tài liệu Dissecting the E ect of Credit Supply on Trade: Evidence from Matched Credit-Export Data  pdf

Ngày tải lên : 16/02/2014, 03:20
... customs data on the universe of Peruvian exports The main novelty of these data is that they allow us to estimate the elasticity of exports to credit after controlling for determinants of exports at ... product-destination level Our empirical strategy exploits the detail of the customs data by comparing the export growth of the same product and to the same destination by firms that borrow from banks that ... two data sets from the Peruvian bank regulator Superintendence of Banking, Insurance, and Pension Funds (SBS) All data are public information We collect the customs data from the website of the...
  • 49
  • 517
  • 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc

Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc

Ngày tải lên : 16/02/2014, 09:20
... splitting pattern as that of the HE-TPP radical intermediate observed during the decarboxylation of pyruvate (Fig 4), indicating that the HE-TPP radical was a common intermediate in both the oxidative ... One unit of enzyme activity was defined as the reduction of lmolÆmin)1 of NADH (corresponding to the carboxylation of lmolÆmin)1 of acetyl-CoA) Quantification of CoA The concentration of CoA was ... Electrochemical oxidation of enamines related to the key intermediate on thiamin diphosphate dependent enzymatic pathways: evidence for one-electron oxidation via a thiazolium cation radical J Am...
  • 10
  • 619
  • 1
Tài liệu Accounting Practices and the Market Valuation of Accounting Numbers: Evidence from Indonesia, Korea, Malaysia, the Philippines, Taiwan, and Thailand doc

Tài liệu Accounting Practices and the Market Valuation of Accounting Numbers: Evidence from Indonesia, Korea, Malaysia, the Philippines, Taiwan, and Thailand doc

Ngày tải lên : 17/02/2014, 09:20
... The evidence seems clear that strongly conservative (biased) accounting is less value relevant The evidence concerning violations of the CSR is less clear Conceptually, violations of CSR that ... and allow a better separation of the explanatory power of book value and earnings Second, we investigate the effects of different price dates in the relation We find that year-end stock prices ... Tohmatsu International Deloitte Touche Tohmatsu International 1996b Taiwan: International Tax and Business Guide New York: Deloitte Touche Tohmatsu International Deloitte Touche Tohmatsu International...
  • 26
  • 712
  • 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx

Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx

Ngày tải lên : 17/02/2014, 22:20
... temperature of over 23 in summer, decreased most symptoms.41) Particulate Matter Particulate matter is suspended in the air in solid and liquid states Previous investigations have noted that particles ... systematic review of provocation studies, J Allergy Clin Immunol., 118, 1257–1264 Hojo, S., Sakabe, K., Ishikawa, S., Miyata, M and Kumano, H (2009) Evaluation of subjective symptoms of Japanese patients ... exposure to volatile organic compounds.31) A systematic review of provocation studies concluded that individuals with MCS reacted to chemical challenges, suggesting that the mechanism of action is...
  • 14
  • 940
  • 1
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Ngày tải lên : 19/02/2014, 02:20
... 5¢-GCTAAAAATAA R105HTGGAGCACTCCATTTTTAGCGCTCGC-3¢ rev: 5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTAT TTTTAGC-3¢ R105K-fwd: 5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢ R105K-rev: 5¢-GCG AGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢ ... substrate binding (Y70 and Q81) The steady-state kinetics of Dm-dNK is compulsory ordered with formation of a ternary complex [1,2] Pre-steady-state measurements indicate that either the catalytic ... (red) illustrating the binding of the feedback inhibitor dTTP and the position of Mg2+ in the active site Mg ion that coordinates the phosphates of dTTP (Fig 3) Discussion Mutation of residues...
  • 10
  • 504
  • 0
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Ngày tải lên : 19/02/2014, 05:20
... clear that VsEndA adapts to lower temperatures by increasing the kcat The similar Km values of the two enzymes may indicate that VsEndA is meant to function at high substrate concentrations, at which ... GCTTTTAAAGTTGACTTCAAAG CTTTGAAGTCAACTTTAAAAGC CTACCATGGCACCTCCTTCTTCTTTCTCAA GCTGTCGACTTATTTAGTGCATGCTTTATAAACAA CTACCATGGCCCCCATCTCTTTTAGTCAT GCTGTCGACTCAGTTCGGGCATTGCTCAC polymerase from Promega were used in the ... Fixed amounts of enzyme were incubated at seven different substrate concentrations ranging from 23 to 1470 nm at 5, 15, 25, 30 and 37 °C in a total reaction volume of 100 lL The amounts of VsEndA...
  • 12
  • 565
  • 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Ngày tải lên : 19/02/2014, 17:20
... ggtatccgcggcattgatcaagcagttg ggtgtcgctgatgctgtcagcgccg gattctgtcagcggcggtgattctctatcag caggtgtgggcagctatcgccccagcgc ggcatttatcgccgctgcgctgtataagcatg cgccccagcggcgtataagcatgaacgtcg gctgtataagcatcagcgtcgcctggtggtg ... gctgtataagcatgcacgtcgcctggtg ctgtataagcatgaagctcgcctggtggtgcc gtataagcatgaacgtgccctggtggtgccg ccagctctctgctggcttatatcggcatggc ctgctgttttatatcgccatggcattcgcctac ccgacatcgccagcagcttaagcttcgttatggc ... effects of the TatA ⁄ 3Gly mutations can be rescued by the presence of additional mutations either elsewhere in the TatA TM span or in the TatB TM span (TatB ⁄ V12P mutation) Mutagenesis of TatC TatC...
  • 15
  • 532
  • 0
Tài liệu Báo cáo khoa học: Steady-state and time-resolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli ppt

Tài liệu Báo cáo khoa học: Steady-state and time-resolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli ppt

Ngày tải lên : 20/02/2014, 23:20
... 5Â-ATTAATGTGAGTTAGCTCACTCATT A-3Â and 3Â-TAATTACACTCAATCGAGTGAGTAAT-5Â; gal (26 bp), 5Â-AAAAGTGTGACATGGAATAAATT AGT-3Â and 3Â-TTTTCACACTGTACCTTATTTAATCA-5Â; ICAP (28 bp), 5Â-AATTAATGTGACATATGTCACAT ... investigate the dynamics of CRP Experimental procedures Materials Fig Structure of the CRP dimer The locations of tryptophan residues are marked in red, and the location of Cys178 residue is indicated ... applied at a ow rate of mLặmin)1, with spectrophotometric detection at 215 nm and uorescence detection at an excitation wavelength of 336 nm and an emission wavelength of 490 nm Steady-state uorescence...
  • 11
  • 494
  • 0
Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc

Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc

Ngày tải lên : 22/02/2014, 09:20
... pitchers.6 Another indicator of a pitcher’s The exact definitions of the batting measures are as follows: batting average equals the number of hits divided by the number of at- bats On-base-percentage ... transformation of itself As stated above, identification of β and β comes from seeing whether variation within player i’s performance levels across years is correlated with the performance levels of ... pitchers than batters (the coefficient of variation for a pitcher’s ERA is 12 times larger than the coefficient of variation of a batter’s batting average: 1.94 for pitchers versus 0.152 for batters in...
  • 33
  • 436
  • 0
Credit channel, trade credit channel, and inventory investment: evidence from a panel of UK firms pot

Credit channel, trade credit channel, and inventory investment: evidence from a panel of UK firms pot

Ngày tải lên : 06/03/2014, 08:20
... test of second-order autocorrelation of the residuals indicate problems with the specification of the model or the choice of the instruments Column of Table presents the estimates of Equation ... that differentiating the effect of the coverage ratio for various categories of firm-years improves the specification of the model Overall, our two sets of tests suggest that there is some evidence ... corporate investment: evidence from panel data.’ Journal of Finance, 4, pp 1425-60 Wilner, B (2000) ‘The exploitation of relationship in financial distress: the case of trade credit.’ Journal of...
  • 32
  • 443
  • 0
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Ngày tải lên : 06/03/2014, 08:20
... effects of each explanatory variable on the estimated probability of being profitable (non-profitable) Table - Loss Equations Explanatory Variables Model (1) f1 Model (2) -0,339 (-4,50) Explanatory ... and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey ENTERPRISE ADJUSTMENT AND THE ROLE OF B ANK CREDIT IN RUSSIA: EVIDENCE FROM A 420 FIRM'S QUALITATIVE SURVEY* ... consistency of the database and to extract principal components from the set of economic indicators Graph reflects the results of an MCA analysis made on a sub-set of eight explanatory variables...
  • 30
  • 635
  • 0
THE EFFECTS OF MEGAMERGERS ON EFFICIENCY AND PRICES: EVIDENCE FROM A BANK PROFIT FUNCTION docx

THE EFFECTS OF MEGAMERGERS ON EFFICIENCY AND PRICES: EVIDENCE FROM A BANK PROFIT FUNCTION docx

Ngày tải lên : 06/03/2014, 08:21
... effects of transition costs Fortunately, Berger and Humphrey (1992) found that merger cost results remained materially unchanged whether the single year of data, years of data, or years of data subsequent ... these profitability ratios are likely less accurate indicators of efficiency than are the improvements in the profit efficiency ratio A(m/mO) and the profitability ratios may also incorporate the ... there have been no academic studies of profit efficiency effects and very few studies of the market power effects of bank mergers Prior studies of bank profitability ratios, such as return on assets...
  • 66
  • 470
  • 1
Human Capital and the Development of Financial Institutions: Evidence from Thailand docx

Human Capital and the Development of Financial Institutions: Evidence from Thailand docx

Ngày tải lên : 06/03/2014, 10:20
... regions separately The presence of a village bank is positively related to the average education of the heads of village households The estimates in the second panel of the table indicate that if the ... operate at the intersection of a number of issues where the education of various actors may be crucial These institutions are self-regulating and managed by members of the village The accuracy of ... their implications for the parametric estimation, these figures suggest that variations in village education will effect 10 bank policies more dramatically than variation in the education of the bank...
  • 38
  • 515
  • 0

Xem thêm