evidence for a role of cytokines in osteoclastic bone resorption

báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx

báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx

... both parental Page of 18 linkage maps (Additional file 3) The mapping data set for LG 18 in Ruby Seedless (RS) and Sultanina (S) included a total of 27 co-dominant markers (Additional file 4), among ... 5-AAGCCAAGGAATCACCCATT-3; for the internal reference gene EF1 -a (GSVIVT00024496001-8.4x) the oligos are 5-AGGATGGACAAACCCGTGAG-3 and 5-AAGCCAGAGATGGGGACAAA-3, and the amplicons have a predicted size of 232 ... without increasing the population size is of great interest Moreover, genetic mapping of intragenic VvAGL11 markers, in addition to revealing a putative functional role of the regulatory of the coding...

Ngày tải lên: 11/08/2014, 11:21

19 389 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... In Madin–Darby canine kidney (MDCK) cells, a study of chimeric forms of DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information while the short cytoplasmic ... plasma membrane of hepatocytes Exp Cell Res 173, 473–485 Weisz OA, Machamer CE & Hubbard AL (1992) Rat liver dipeptidylpeptidase IV contains competing apical and basolateral targeting information ... notably albumin (66 kDa), indicating that during permeabilization, soluble luminal proteins were washed out (Fig 4B) A number of proteins ‘disappeared’ following treatment with proteinase K alone...

Ngày tải lên: 19/02/2014, 07:20

12 738 0
Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx

Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx

... potential importance in our understanding of the role of circulating and tissue sources of ACE2, particularly in various disease states Increased circulating levels of ACE2 may reflect a compensatory ... ACE inhibition ameliorated the autoimmune in ammation [7] The present findings by Takahashi and colleagues reveal increased expression of circulating ACE2 in patients with vasculopathy utilizing ... renin–angiotensin system and in ammatory events [5] Pre-eclampsia is associated with circulating autoantibodies against the AT1 protein that act as functional receptor agonists to promote vasoconstriction and...

Ngày tải lên: 12/08/2014, 14:22

2 364 0
Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot

Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot

... Central Register of Controlled trials, Cochrane database of systematic reviews, American College of Physicians Journal Club, Health Technology Assessment Database and Database of Abstracts of Reviews ... colleagues Annane and Table Trial patient data by outcome (Continued) #, mortality statistics for Chawla and colleagues [47] were abstracted from the Annane and colleagues meta-analysis[6] ##, data ... fulfilling inclusion criteria and pre-defined variables and outcomes were abstracted into standardized data abstraction forms Quality assessment on the published studies was performed in an un-blinded...

Ngày tải lên: 13/08/2014, 21:21

15 536 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

... polysaccharides, including arabinan, arabinoxylan and arabinogalactan [6,7] ABNs attack the glycosidic bonds of the a- 1,5-l-arabinan backbone, releasing a mixture of arabinooligosaccharides and larabinose ... significant amounts in homopolysaccharides, branched and de-branched arabinans, and heteropolysaccharides such as arabinoxylans and arabinogalactans Arabinan is composed of a- 1,5-linked l-arabinofuranosyl ... N-terminal domain and interacts with the C-terminal domain is shown in red catalytic domain with the Ca trace of BsArb4 3A from B subtilis (Protein Data Bank code 1UV4 [15]), a- larabinanase (CjArb4 3A) ...

Ngày tải lên: 15/03/2014, 23:20

13 568 0
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx

... applied and (c) assume a similar role by putative endogenous ouabain or OLF Ouabain-sensitive and -insensitive a- isoforms of Na+/K+-ATPase in rats All isoforms of the catalytic a- peptide of Na+/K+-ATPase ... larger changes in intracellular Na+ and Ca2+ may thus be the result of a ouabain interaction with subpopulations of Na+/K+ATPase [27] An overall increase in intracellular Na+ was seen in the experiments ... to rat Na+/K+-ATPase isoforms and actual ouabain or OLF concentrations The figure summarizes the huge variation in ouabain a nities of Na+/K+-ATPase depending on species and a- isoforms, actual...

Ngày tải lên: 23/03/2014, 17:21

4 423 0
báo cáo khoa học: " Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper" pptx

báo cáo khoa học: " Multiple evidence for the role of an Ovate-like gene in determining fruit shape in pepper" pptx

... subfamilies, the one with CaOVATE, AtOFP6, AtOFP7 and AtOFP8 and the other with AtOFP1, AtOFP2, AtOFP3 and AtOFP5, have a significant number of common amino-acids inside the domain According ... segregation into subfamilies (Figure 2) The DUF623 domain of the CaOVATE was categorized in the same subfamily as other Solanaceous plants and the DUF623 domains of AtOFP7, AtOFP8 and AtOFP6 AtOFP7 ... domain, characteristic of OFPs Bioinformatics analysis placed CaOVATE in the same protein subfamily with functionally equivalent proteins from Solanaceae plants, including tomato, and three OFP...

Ngày tải lên: 11/08/2014, 11:21

16 504 0
Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

... cross-reacted with a protein exhibiting an apparent molecular mass of approximately 25–26 kDa, a value similar to that of ferritins This reactivity was achieved in all types of preparations In particular, ... (Table 3) The data presented in this paper strongly indicate a mitochondrial localization for ferritins in P sativum and A thaliana and could be rationalized as follows: the protein may be targeted ... encodes a 242 amino acid precursor of a ferritin H-like Table Calculated values for prediction of mitochondrial targeting for some plant ferritins Scores were obtained from different programs available...

Ngày tải lên: 16/03/2014, 18:20

8 504 0
Báo cáo Y học: Evidence for general stabilization of mRNAs in response to UV light pdf

Báo cáo Y học: Evidence for general stabilization of mRNAs in response to UV light pdf

... LPS and IL-1 induce stabilization of several AU-rich mRNAs by activating the p38 MAP kinase/MK2 pathway [16,18] However, p38 MAP kinase activation did not affect the degradation of non-AREcontaining ... Interaction of proteins from cytoplasmic extracts with labeled GM-CSF ARE RNA was assayed as described in (A) UV light but not activation of p38 MAP kinase increases cytoplasmic HuR-binding activity ... Resch, K & Holtmann, H (1999) The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase and an AU-rich region-targeted mechanism EMBO J 18,...

Ngày tải lên: 31/03/2014, 08:20

10 452 0
Báo cáo sinh học: "Search for a ‘Tree of Life’ in the thicket of the phylogenetic forest" doc

Báo cáo sinh học: "Search for a ‘Tree of Life’ in the thicket of the phylogenetic forest" doc

... D0) and swapping a random pair of branches Additional data files Additional data file contains a list of species (59 bacterial and 41 archaeal) used for the FOL construction Additional data file ... indications of HGT between archaea and bacteria (13% from archaea to bacteria, 23% from bacteria to archaea and 8% in both directions; see Materials and methods for details and Additional data file 3) In ... vertical inheritance permeating the entire history of archaea and bacteria A contribution from ‘highways’ of HGT (that is, preferential HGT between certain groups of archaea and bacteria) that could...

Ngày tải lên: 06/08/2014, 19:20

17 440 0
Báo cáo y học: "Association of ITGAV supports a role of angiogenesis in rheumatoid arthritis Peter Ahnert and Holger Kirsten" pps

Báo cáo y học: "Association of ITGAV supports a role of angiogenesis in rheumatoid arthritis Peter Ahnert and Holger Kirsten" pps

... data in public databases such as dbGaP [13] for use in (disease sub-type-specific) meta-analyses ITGAV is the latest example of a candidate gene that may be relevant to RA Increased significance ... Migliorini P, Balsa A, Westhovens R, Barrera P, Alves H, et al.: The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study Arthritis ... step on the way to a better understanding of RA etiology and pathomechanisms, in particular the role of angiogenesis Page of (page number not for citation purposes) 10 11 12 13 Jacq L, Garnier S,...

Ngày tải lên: 09/08/2014, 10:21

2 465 0
Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf

Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf

... pQE-Rv_0811c CGGTATAACAGCCGGCCTTAAAGCTG PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC PygfZG227AR pQE-ygfZK22 6A GTCCGGTATAACAGGCTTTCTTAAAG pQE-ygfZG22 7A PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG PygfZC228AR CTTGTCCGGTATAAGCCCCTTTCTTAAAG ... GTCCGGTATACATGCCTTTCTTAAAG PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA PygfZT230AF AAGGCTGTTATGCCGGACAAGAGATG PygfZT230AR pQE-ygfZC228M pQE-ygfZY22 9A CATCTCTTGTCCGGCATAACAGCCTT ... CTTGTCCGGTATAAGCCCCTTTCTTAAAG PygfZC228SF CTTTAAGAAAGGCTCGTATACCGGAC PygfZC228SR CTTTAAGAAAGGCATGTATACCGGAC PygfZC228MR pQE-ygfZC228S GTCCGGTATACGAGCCTTTCTTAAAG PygfZC228MF pQE-ygfZC22 8A GTCCGGTATACATGCCTTTCTTAAAG...

Ngày tải lên: 10/08/2014, 05:21

13 440 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... hence activates CASP9 leading to the caspase cascade resulting in apoptosis G2 arrest and DNA damage signaling could also activate BAX leading to mitochondria-mediated apoptosis On the other hand, ... lipid, and amino acid metabolisms are also illustrated In the remaining three categories, butanoate and fatty acid metabolism were top listed in carbohydrate and lipid metabolism The valine, leucine,...

Ngày tải lên: 13/08/2014, 01:20

21 376 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... BMP/activin pathway in Crassostrea gigas ted of its highly variable C-terminal domain after the terminal conserved arginine of the cytoplasmic serine ⁄ threonine kinase domain Sequences for phylogenetic ... transmembrane domain and the serine ⁄ threonine kinase domain FEBS Journal 272 (2005) 3424–3440 ª 2005 FEBS 3427 BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 ... below A full length 1907 base pair cDNA clone containing an open reading frame encoding 534 amino acids was isolated from a C gigas mantle edge library The predicted protein contained a number of...

Ngày tải lên: 07/03/2014, 21:20

17 509 0
Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt

Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt

... ConA (D) Fig Characterization of the transgenic silkworm line L6 · (A) Illustration of a recombinant transforming vector and normal and mutant L-chain genes (a) Arrangement of two genes in pBac(3xP3DsRed2 ... We can calculate molecular masses of fhx/P25 containing different numbers of mannose residues as follows: 29.74 kDa for a molecule containing three chains of GlcNAc2Man9 and 27.58 kDa for a molecule ... but also L-chain play respective roles in the formation of the integral structure of the elementary unit of fibroin Acknowledgements We thank Kazuko Seo and Hiroko Yamazaki, National Institute of...

Ngày tải lên: 16/03/2014, 16:20

11 552 0
Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

... large stomatal opening that induces transpiration is a necessary consequence of the plant’s need to maintain gas exchange in leaves for photosynthesis To maintain a favourable water balance, an ... gs values decreased drastically for Ψ values close to the values of Ψcav for the two kind of branches Shade and sun branches presented an early stomatal regulation during drying and stomatal closure ... branches are able to sustain a high climatic water demand and are able to resist to water deficit by maintaining xylem integrity with a low vulnerability and an efficient stomatal response Vulnerability...

Ngày tải lên: 08/08/2014, 14:20

10 329 0
báo cáo khoa học: "A role of 18F-fluorodeoxyglucose positron emission/computed tomography in a strategy for abdominal wall metastasis of colorectal mucinous adenocarcinoma developed after laparoscopic surgery" pptx

báo cáo khoa học: "A role of 18F-fluorodeoxyglucose positron emission/computed tomography in a strategy for abdominal wall metastasis of colorectal mucinous adenocarcinoma developed after laparoscopic surgery" pptx

... does have some disadvantages False-negative findings can occur for several reasons, including inflammation, small lesions size and diabetes Mucinous adenocarcinoma as a histological type, regardless ... resected in February 2009 The tumor was located in the abdominal wall, slightly exposed to the abdominal cavity There was no gross evidence of metastasis in the abdominal cavity and cytological examination ... read and approved the final manuscript Figure Pathological findings Metastatic tumor The tumor was located in the abdominal wall, slightly exposed to the abdominal cavity Clinico-pathological...

Ngày tải lên: 09/08/2014, 01:24

5 375 0
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

... to as relative pupil area (rPA) was obtained by dividing the pupil area by the iris area Only the rPA values obtained during the light exposure periods were analyzed All of the rPA values for a ... data analyses and interpretation, and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The author(s) declare that they have no competing interests ... melanopsin in the photosensitive RGCs of the albino Wistar rat follow a circadian pattern Finally, these findings might provide additional insight into the reported changes in visual thresholds at...

Ngày tải lên: 10/08/2014, 09:20

9 363 0
Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

... and design, acquisition of data, and analysis of data AP, SM, CG, OLS, VV and ER have been involved in drafting the manuscript or revising it, and for critical review of important intellectual ... hypoxia and lactic acidosis can maintain all the described pathophysiologic mechanisms and induce a relative deficiency in vasopressin plasma concentration further amplifying the vasoplegic scenario ... postoperative normalization of plasma lactate levels Conclusion In case of anaphylactic shock, continuous infusion of lowdose vasopressin might be considered in the treatment algorithm after inadequate...

Ngày tải lên: 11/08/2014, 11:20

4 370 0
Báo cáo y học: "Evidence for a second class of S-adenosylmethionine riboswitches and other regulatory RNA motifs in alpha-proteobacteria" pps

Báo cáo y học: "Evidence for a second class of S-adenosylmethionine riboswitches and other regulatory RNA motifs in alpha-proteobacteria" pps

... GGCCG.AGG AAC.AUGCC GAUUUGAUA AUCAGCUUGCG.GGCAU UAAAAAACA GCUAAAGC.GGU GCA AAGUGUGGACAGAUUU GAGCAGCUUGCA.ACCACGGAAAAAAAU GCUAAAACACGUC UUG UUCGGCGCC GAUUUGC CUGAUCCGCUUGCG.GGCGCCUCUUAUAAAUCCAGCUAAAGA.GGUCUGAAU ... UCCCGUGGU GAUUUGGC CGGUCGGCUUGCA.GCCACGUUAAACAAGUC GCUAAAG GACCG.UUG AGCCGUGGU GCUUUG UGCCGGAUUGCGGGCCACGUUAAAGAAACC GCUAAAGA.GGCG AGG ACUCGUGGU CAUUUGAGC.CGGCCGGCUUGCA.GCCACGUUAAACAACUC GCUAAACA.GGCCG.GGG ... UCCCGUGGU GAUUUGAG.CCGGCCGGCUUGCA.GCCACGUUAAACAAGUC GCUAAACA.GGCCGGGGA UCCCGUGGU GAUUUGGC CGGUCGGCUUGCA.GCCACGUUAAACAAGUA GCUAAAAA.GGCCG.GGU AUCCGUGGU GAUUUGGC CGGCCGGCUUGCA.GCCACGUUAAAGAAGUC GCUAAAG...

Ngày tải lên: 14/08/2014, 14:22

10 401 0
w