evaluation of vitamin a intake among athletes
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx
Ngày tải lên :
18/06/2014, 15:20
... combination with dasatinib, migration/invasion assays and cell cycle assays P < 0.05 was considered statistically significant ANOVA one way analysis was performed to compare dasatinib alone, taxotere/epirubicin ... B) sorafenib in a panel of melanoma cell lines Percentage growth inhibition by A) dasatinib and B) sorafenib in a panel of melanoma cell lines Error bars represent the standard deviation of triplicate ... dasatinib in melanoma cell lines observed in this study provide strong evidence for evaluation of dasatinib in clinical trials in melanoma patients Two clinical trials of dasatinib in melanoma are...
- 11
- 476
- 0
Báo cáo y học: "Prothrombin complex concentrate in surgical patients: retrospective evaluation of vitamin K antagonist reversal and treatment of severe bleeding" pdf
Ngày tải lên :
13/08/2014, 20:21
... de Coul AA, van Gijn J: Intracerebral hematomas during anticoagulant treatment Stroke 1990, 21:726-730 Butler AC, Tait RC: Management of oral anticoagulant-induced intracranial haemorrhage Blood ... reversal and bleeding surgical patients appears to be effective with a favorable safety profile and, as such, warrants further prospective evaluation manuscript, and financial support for this assistance ... and nanofiltration to facilitate viral inactivation and elimination [19] As PCCs are able to normalize levels of vitamin K-dependent clotting factors, and re-establish hemostasis, they may also...
- 15
- 397
- 0
báo cáo khoa học: " Process evaluation of a participatory ergonomics programme to prevent low back pain and neck pain among workers" pdf
Ngày tải lên :
10/08/2014, 10:23
... decision authority, a maximum of eight workers who were a solid representation of the largest and most important task groups at the department If available, an occupational health and safety coordinator ... intervention aimed at improving musculoskeletal health Am J Ind Med 2006, 49:801-810 22 Haukka E, Leino-Arjas P, Viikari-Juntura E, Takala EP, Malmivaara A, Hopsu L, Mutanen P, Ketola R, Virtanen T, ... higher management of all companies agreed with the financial and organisational consequences of the intervention Based on their main workload, participating departments were classified into: mental,...
- 11
- 291
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
Ngày tải lên :
26/10/2012, 09:07
... 2004; 5: 15 Manchukonda R, Manchikanti KN, Cash KA, et al Facet joint pain in chronic spinal pain: An evaluation of prevalence and false-positive rate of diagnostic blocks J Spinal Disord Tech ... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... quality of individual articles has shown a sample size of 50 patients in the smallest group as acceptable.46 Randomization Sixty patients were randomly assigned into each group from a total of...
- 12
- 669
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
Ngày tải lên :
23/04/2013, 21:38
... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... 2009): ((AUC ) × Dose ) × 100% ((AUC ) × Dose ) A BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated ... chemical reagents were of analytical grade and obtained from commercial sources ICR mice and Wistar rats were purchased from the Institute of Radiology, Chinese Academy of Medical Science All animal...
- 7
- 391
- 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
Ngày tải lên :
05/09/2013, 09:38
... 2009 Fig Location of the artificial and natural tidal flats in Tategami, Ago bay, Mie, Japan Table Sediment of artificial tidal flats in real seashore Run E1 E2 E3 E4 E5 Granulation of DS 1.5wt% ... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... have the same physicochemical and biological structures as natural tidal flats, and that silt accumulation in the sediment is a key parameter for the creation of a natural-like artificial tidal...
- 13
- 586
- 0
Evaluation of Nutrient Loads from a Citrus Orchard in Japan
Ngày tải lên :
05/09/2013, 10:15
... showed that the Case evaluation gave a higher discharge than in Case Kunimatsu et al (2006) calculated cv (coefficient of variation) values of the annual loads in Mano River (watershed area of 16.4 ... station by Japan Meteorological Agency (2008) Load Estimations Load evaluation of Case was calculated by water discharge and nutrient load from our only weekly research data (Table 1) In the Case ... of TP was avoided in this study Evaluation of phosphorus loads will require the establishment of a seasonally separated equation model that takes into account rainfall events and seasonal changes...
- 10
- 425
- 0
Thermal evaluation of a sun tracking solar cooker
Ngày tải lên :
05/09/2013, 17:03
... double-glazed solar cooker, Kumar [7] One of the earliest mathematical models to test the thermal performance of a Solar Cooker was presented by Garg et al [8] and Vaishya et al [9] Also, Jubran and Alsaad ... solar cooker, and the parameters that characterize the performance of the solar cooker Evaluation of solar cooker thermal performance using different insulating materials was conducted by Mishra ... and management vol 32 (6): pp 537-541 R S Mishra, S P Prakash, 1984, Evaluation of solar cooker thermal performance using different insulating materials, International Journal of Energy Research...
- 8
- 423
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
Ngày tải lên :
16/01/2014, 21:20
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...
- 8
- 492
- 0
Tài liệu Evaluation of possible Six Sigma implementation including a DMAIC project pptx
Ngày tải lên :
24/01/2014, 00:20
... utvalda individer Författarna menar att Sex Sigma kan implementeras och integreras i det nuvarande förbättringsarbetet, Total Process Management (TPMG) Sex Sigma kan användas för att attackera ... reporting and improved use of SPC are important actions that need to be taken -SAMMANFATTNING- SAMMANFATTNING Sex Sigma fokuserar på att reducera variation samt att kontinuerligt förbättra företagets ... MBNQA is an annual quality award in the USA and was established in 1987 when the sitting president Ronald Reagan signed the MBNQ improvement Act The award is named after a former American Secretary...
- 120
- 486
- 2
Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt
Ngày tải lên :
14/02/2014, 06:20
... 57(545):979-86 31 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs American Association of Cardiovascular and Pulmonary Rehabilitation edition Champaigh, IL.: Human Kinetics; ... Portugal 4Maia Institute of Higher Education (CIDESD), Portugal Authors’ contributions AIM participated in the acquisition and analysis of data and participated in drafting and editing the manuscript ... approaches to statistical analysis of data including frequencies and percentages for the categorical data, performed with the Statistical Package SPSS, version 17.0 Data presentation A set of the...
- 16
- 959
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
Ngày tải lên :
20/02/2014, 09:20
... which are not asked, and also contain practical examples Human-powered answers often contain unrelated information and discourselike elements Additionally, the answers not always have a connection ... $0.01 Amazon.com collects a 10% (or a minimum of $0.05) service fee per each paid reward • Qualifications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” ... both answers We calculated the overall average agreement ratio (Total Avg) and the average of the best matches between two assignments within one HIT (Best Match) We ran the test for two data sets:...
- 9
- 610
- 1
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
Ngày tải lên :
22/02/2014, 02:20
... was not trained on enough data Belz and Reiter (2006) carry out a comparison of automatic evaluation metrics against human domain experts and human non-experts in the domain of weather forecast ... based on automatic evaluation metrics published in that paper are confirmed in an evaluation by humans Another goal is to collect data that will allow us and other researchers1 to explore ... breakdown of the items A ranking mechanism based on so-called optimality marks can lead to a certain “asymmetry” between parsing and in each part of the experiment.5 generation in the sense that not all...
- 9
- 479
- 0
Trajectory Patterns of Self-Rated Health among the Elderly in Taiwan: A Comparison across Ethnicity pptx
Ngày tải lên :
05/03/2014, 18:20
... population have been collected Among the studies that have made use of the data, Tung and Mutran (2005) compared two measures of health status (self-rated health and functional and disability status) ... 50% of them are illiterate So, a plausible explanation of why low education is not predictive of mortality among the Mainlanders might be that a majority of them have at least some years of schooling, ... Journal of Aging Health 5: 140-153 Liang, J., B A Shaw, N Krause, J Bennett, E Kobayashi, T Fukaya, and Y Sugihara 2005 "How Does Self-Rated Health Change with Age? A Study of Older Adults in Japan."...
- 34
- 346
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
Ngày tải lên :
07/03/2014, 12:20
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and...
- 11
- 571
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
Ngày tải lên :
08/03/2014, 07:20
... nonterminal labels of the treebank g r a m m a r For example, our g r a m m a r maintains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of t ... (viz a year) or else a number Note t h a t all of these classifications were m a d e on the basis of the examination of concordances over a several-hundredthousand-word sample of manuals data Possible ... be ascertained The value of a large bracketed training corpus is that it allows the grammarian to obtain quickly a very large set of sentences that 2Actually there are 18 x = 54 labels, as each...
- 8
- 562
- 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
Ngày tải lên :
08/03/2014, 08:20
... primers (5¢-TGAGTGCA AGCGGTGTCTTA-3¢ (forward) and 5¢-TAGTGGTGA TGTGCCCATG-3¢ (reverse); primers for p21WAF1/CIF1: 5¢-ACAGCGATATCGAGACACTCA-3¢ (forward) and 5¢-GTGAGACACCAGAGTGCAAGA-3¢ (reverse); ... provides a mechanism that cult parturition in the rat as a result of vitamin A deficiency Am J Anat 57, 303–349 may explain in part the regulation of control of proliferative Ó FEBS 2003 Vitamin A status ... primers for p53: 5¢-CACAGTCGGATATGAGCATC-3¢ (forward) and 5¢-GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1: 5¢-TGTTCGTGGC CTCTAAGATGA-3¢ (forward) and 5¢-GCTTGACTCCA GAAGGGCTT-3¢ (reverse);...
- 9
- 508
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
Ngày tải lên :
08/03/2014, 23:20
... Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou Caribou Caribou Caribou Caribou Caribou Caribou Conant silt loam Conant silt loam Conant silt loam Daigle silt loam ... fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt ... Howland gravelly loam Howland gravelly loam Howland gravelly loam Howland very stony loam Howland very stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine...
- 131
- 599
- 0