estimation of the minimum eigenvalue a 0

báo cáo hóa học: " Study of the asymptotic eigenvalue distribution and trace formula of a second order operatordifferential equation" ppt

báo cáo hóa học: " Study of the asymptotic eigenvalue distribution and trace formula of a second order operatordifferential equation" ppt

... formula for eigenvalue distribution of L0 Suppose that the eigenvalues of A are gn ~ ana (n ® ∞, a >0, a >0) Then, by virtue of the spectral expansion of the self-adjoint operator A, we get the ... interpretation, and modification of the initial version of this study Author details Department of Differential Equation, Institute of Mathematics and Mechanics-Azerbaijan National Academy of Science, ... regularized trace of the considered problem will be studied It is clear that because of the appearance of an eigenvalue parameter in the boundary condition at the end point, the operator associated...

Ngày tải lên: 21/06/2014, 02:20

22 334 0
Báo cáo lâm nghiệp: "Estimation of carbon stocks in a beech forest (Fougères Forest – W. France): extrapolation from the plots to the whole forest" pps

Báo cáo lâm nghiệp: "Estimation of carbon stocks in a beech forest (Fougères Forest – W. France): extrapolation from the plots to the whole forest" pps

... sativa Mill Fagus sylvatica L Frangula alnus Mill Fraxinus excelsior L Huet et al., 200 4 [ 20] Huet et al., 200 4 [ 20] Ranger et al., 1981 [42] Le Goff et al., 200 4 [31] Van de Walle et al., 200 1 ... of the estimation method at the whole forest scale The determination of age classes carried out using cartographic data and data in the literature was generally efficient The choice of the sampling ... contained about half of the carbon stocks ( 50. 2%) with a total variation between 222 00 0 and 239 00 0 tC The hydromorphic zones only represented a small part of the stock due to their limited area...

Ngày tải lên: 08/08/2014, 00:22

10 361 0
Báo cáo sinh học: "Use of sib-pair linkage methods for the estimation of the genetic variance at a quantitative trait locus" pps

Báo cáo sinh học: "Use of sib-pair linkage methods for the estimation of the genetic variance at a quantitative trait locus" pps

... variances of 40, 80 and 1 20 were assumed This resulted in a total of 30 different variants, each of them being simulated with 00 0 replications Analysis of simulation results The power of the ... contrast to the estimation of QTL variance, this leads to an underestimation of recombination fractions for small values Table IV shows that for a QTL variance of 40 the estimators are heavily biased ... that the method is robust against a variety of distributions of the trait examined and that it can also make use of multivariate data (Amos et al, 1989) G6tz and Ollivier (1992) found that in animal...

Ngày tải lên: 09/08/2014, 18:21

14 299 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

... populated countries of the world, with a population of about 129 million in 200 1(Bangladesh Bureau of Statistics, 200 2) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban ... water bodies such as a canal and ponds It was partly because the people had considered the biogas plant as maintenance free and they did not any maintenance at all with lack of the appropriate ... cost sharing The installation cost of biogas plant sewerage system is about 1 20, 000 to 152 ,00 0 Taka (1 US dollar=57. 80 Taka in October 200 2) During first testing of the system in 1995, the local...

Ngày tải lên: 05/09/2013, 09:08

9 972 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx

Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx

... in the application and the written arguments presented in the appeal briefs After careful consideration of these materials, we hold that the refusal to register must be affirmed As applicant ... registration are unrelated to those listed in the application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board instituted the ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written...

Ngày tải lên: 20/12/2013, 23:15

8 416 0
Tài liệu THE ESTIMATION OF THE EFFECTIVE REPRODUCTIVE NUMBER FROM DISEASE OUTBREAK DATA pdf

Tài liệu THE ESTIMATION OF THE EFFECTIVE REPRODUCTIVE NUMBER FROM DISEASE OUTBREAK DATA pdf

... β; and per week, for γ Parameter S0 I0 ˜ β γ True value 3. 500 × 105 9 .00 0× 101 5 .00 0× 10 6 5 .00 0× 10 1 Initial guess Estimate 3. 800 × 105 3.498× 105 9. 900 × 101 9 .08 5× 101 −6 5. 500 × 10 4.954× 10 6 −1 5. 500 × 10 ... outbreaks in the US [12] Season 1997–98 1998–99 1999 00 200 0 01 200 1 02 200 2 03 200 3 04 200 4 05 Mean Total number Number of of tested A( H1N1) & specimens A( H1N2) isolates 99 ,07 2 102 , 105 30 92, 403 ... AND BANKS Table Estimates from a synthetic data set of size n = 1, 00 0, with non-constant variance using α = 0. 075 The R(t) sample size is m = 10, 00 0 The initial guess of the optimization algorithm...

Ngày tải lên: 13/02/2014, 16:20

22 516 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... 1 .0 0. 1 64 68 301 00 ã 10) 7 3.2 0. 6 ã 10) 7 10) 7 ã 10) 15 ã 10) 15 10) 14) 10) 15 FEBS Journal 273 ( 200 6) 47424753 ê 200 6 The Authors Journal compilation ê 200 6 FEBS 4745 Application of a uorescent ... 0. 3 ã 10) 3 5 .0 1.5 ã 10) 4 % 10) 4 2.9 0. 7 ã 10) 10 % 10) 10 % 10) 11 2.7 0. 1 64 74 10 206 0 (65%) ã 10) 6 (25%) ã 10) 4 ã 10) 7 10) 5) 10) 6 1.2 0. 2 ã 10) 13 3.1 0. 4 ã 10) 12 ã 10) 15 10) 13) 10) 14 ... 10) 6 (M)1ặs)1) k (s)1) Kd (M) 0. 75 0. 05 61 % 60 14 92 %9 43 1.5 0. 3 ã 10) 7 % 1.5 ã 10) 7 ã 10) 7 0. 82 0. 08 21 3.5 0. 6 1 60 30 1 40 40 ã 10) 5 4 .0 ã 10) 5 2 .0 0. 1 4.2 0. 4 %4 4 .0 0. 5...

Ngày tải lên: 19/02/2014, 05:20

12 603 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... GGTTGCCTGAGRTGYATHTGa GGGCTATTGGTCAGACGCTACACTC GAGTGTAGCGTCTGACCAATAGCC GATCTGATACGGTCCACACGACAG GCLRCIC GYWSDATL GYWSDATL LSCGPYQI H ¼ A or C or T; R ¼ A or G; Y ¼ C or T transcription The cDNA was ... the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypothetical secreted protein of the nematode Caenorhabditis elegans and with putative ... cm) and absorbance at 2 20 and 2 80 nm was followed Each peptide (0. 2 nmol) was submitted to automated Edman degradation in an Applied Biosystems 47 0A protein sequencer The phenylthiohydantoins of...

Ngày tải lên: 19/02/2014, 12:20

6 738 0
Research Program of the Partnership for a New Generation of Vehicles doc

Research Program of the Partnership for a New Generation of Vehicles doc

... 2 ,00 0 rpm/2 .0 bar 2, 300 rpm/4.2 bar 2, 600 rpm/8.8 bara 40 30 30 18 700 600 375 200 25 N /A 600 375 200 25 aDaimlerChrysler tests were run at 2, 500 rpm at this condition ated on the basis of their ... >3, 500 30 0.2 0. 02 45 43 45 625 >5 ,00 0 30 0 .07 0. 01 46 44 47 6 50 >5 ,00 0 1.5 30 0 .03 0. 01

Ngày tải lên: 06/03/2014, 15:20

134 467 0
Apollonius of Tyana, the Philosopher-Reformer of the First Century A.D. potx

Apollonius of Tyana, the Philosopher-Reformer of the First Century A.D. potx

... Xerxes; they invaded Thessaly and fought at Plataea From the time of Alexander onwards there was direct and constant contact between [ =A] ry[ =a] varta and the kingdoms of the successors of the world-conqueror, ... Life of Apollonius was still so great a difficulty that it gave rise to a new hypothesis of plagiarism The life of Apollonius was a Pagan plagiarism of the life of Jesus But Eusebius and the Fathers ... be a corruption of Arhat.[99] The main burden of Damis' narrative insists on the psychic and spiritual knowledge of the sages They know what takes place at a distance, they can tell the past and...

Ngày tải lên: 07/03/2014, 03:20

61 493 0
Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx

Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx

... effect is ascribed to the high catalytic capacity (Vmax) of the arginase Relevant Mathematica functions were written to extract the distribution of radioactivity, and the total measurable radioactivity ... a more advanced and realistic model of the urea cycle than has been available hitherto The model affords a means of studying the kinetic consequences of enzyme and metabolite compartmentalization ... citRðtÞÞAspðtÞ þ k3;ASS k5;ASS k7;ASS k9;ASS k12;ASS ATP(t) Asp(t) (as(t) þ asR(t)) þ k3;ASS k5;ASS k7;ASS k9;ASS k11;ASS ATP(t) Asp(t) þ k2;ASS k5;ASS k7;ASS k 10; ASS k12;ASS Asp(t) AMP(t) (as(t) þ asR(t))...

Ngày tải lên: 08/03/2014, 08:20

9 438 0
Adventurers of the Far North A Chronicle of the Frozen Seas doc

Adventurers of the Far North A Chronicle of the Frozen Seas doc

... Lake; Hearne speaks of it as Athaspuscow Lake The latter name is the same as that now given to another lake (Athabaska of Canadian maps) the word being descriptive and meaning the lake with the beds ... means of navigation of the day and to the courage of seamen The ships once able to put to sea, the voyage was rapid, and in twenty days Davis was off the south-west coast of Greenland All about ... service of the company, had made his way from York Fort to the plains of the Saskatchewan After the Treaty of Utrecht had brought peace and a clear title to the basin of the bay, the company endeavoured...

Ngày tải lên: 08/03/2014, 15:20

54 472 0
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx

Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx

... FEMA Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and ... currently available for wind engineering research, advances are being made in a number of areas, such as the characterization of wind fields and the evaluation of the performance of the building ... was approved by the Governing Board of the National Research Council, whose members are drawn from the councils of the National Academy of Sciences, the National Academy of Engineering, and the...

Ngày tải lên: 08/03/2014, 19:20

49 588 0
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot

Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot

... by almost all the papal sovereigns of Europe A remarkable circumstance is related of the hopes and intentions of the Spaniards, in the event of success in the Armada A Spanish officer, who was ... gentleman At this stage of the examination, the lord chamberlain saw a man standing in a corner of the cellar, who stated that he was Percy's servant, and that he was left by his master in charge of ... merely to an attempt, on the part of the Romanists, at the commencement of the session, to obtain a toleration for their worship, and the relaxation of some of the penal laws Various attempts have...

Ngày tải lên: 08/03/2014, 22:20

74 422 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... met Online 20 0.8 0. 7 0. 6 0. 5 0. 4 0. 3 0. 2 0. 8 0. 7 0. 6 0. 5 0. 4 0. 3 0. 2 0. 1 0. 1 0 10 20 30 40 50 60 Man's Age when he met Partner 70 80 10 20 30 40 50 60 Woman's Age when she met Partner Source: ... 0. 3 0. 2 0. 1 10 20 30 40 50 Woman's Age 60 70 80 10 30 40 50 Man's Age 60 70 80 70 80 Proportion of Women Who met their Partner Online Proportion of Men Who met their Partner Online 0. 9 0. 9 Proportion ... Heterosexual Women Partnership Rate Heterosexual Men Partnership Rate 0. 9 0. 9 Proportion with a Female Partner Proportion with a Male Partner 0. 8 0. 7 0. 6 0. 5 0. 4 0. 3 0. 2 0. 1 0. 8 0. 7 0. 6 0. 5 0. 4 0. 3 0. 2...

Ngày tải lên: 15/03/2014, 21:20

50 470 0
Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

... fragments The Nogo -A cDNA (designated KIAA 08 86) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fragment encoding a 182 residue Nogo -A fragment ... (designated as Nogo -A( 567–748); Fig 1) was generated by PCR with a pair of primers: 5¢-CG CGCGCGCGGATCCACTGGTACAAAGATTGCT-3¢ (forward) and 5¢-CGCGCGCGCCTCGAGCTAAAAT AAGTCAACTGGTTC-3¢ (reverse) A DNA ... N-terminal helix (7–12) C-terminal helix (26–37) Additional helix ( 20 24) 63.5 2.3 28.5 4.2 21 .0 7.3 ± ± ± ± ± ± 0. 002 0. 400 0. 285 0. 027 6.6 0. 3 1.9 1.1 2.5 2.5 ± ± ± ± 0. 000 1 0. 0135 0. 03 50 0 .00 46...

Ngày tải lên: 16/03/2014, 16:20

11 493 0
modeling of the conduction in a wo3 thin film as ozone sensor

modeling of the conduction in a wo3 thin film as ozone sensor

... by the gas and removed from the surface, the depletion layer and the resistivity are then decreased [9–12] The numerous approaches differ by the adsorption isotherm and the way of evaluating the ... K) are given in Fig 4a and b, respectively We can notice that the low value of the adsorbate ionization rate saturates at a value lower than 5.4 × 10 3 while the total covering rate reaches the ... typically 100 – 300 at 0. 8 ppm However they are very dependent on the variations of process, so the dispersion of characteristics among the different manufacturing batches requires an adjustment of...

Ngày tải lên: 20/03/2014, 13:04

8 662 0
Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc

Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc

... the previous records ( 200 2 200 3, 200 3- 200 4 and 200 4- 200 5), the total number of gynecological malignancy patients reported annually on Friday and Saturday was on an average 215, among the average ... the patients (Sarkar et al., 201 1), making the management of the disease easier Median value of PCI of family of the patients was Rs 400 and mean value was Rs 543 with a range of Rs 100 - 2 500 ... 300 3 Madhutandra Sarkar et al Siyal AR, Shaikh SM, Balouch R, Surahio AW (1999) Gynaecological cancer: A histopathological experiences at Chandka Medical College and Hospital Larkana Med Channel,...

Ngày tải lên: 22/03/2014, 11:20

8 687 0
THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf

THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf

... and Savannah A branch opens in New Orleans D PH 07 08 In February and March, First Bank shareholders hold a meeting to arrange the liquidation of the bank 09 10 11 IA LA EL 06 HI 1 805 05 1 809 THE ... PHILADELPHIA In 1789, he became assistant secretary of the Treasury THE LIBRARY COMPANY OF PHILADELPHIA 1 800 , Adams left Philadelphia for the new capital city, the College of New Jersey (later Albert ... only the largest financial institution in the new nation but also the largest corporation of any type by far The bank’s sale of shares was also the largest initial public Between 1 800 and 1 805 ,...

Ngày tải lên: 22/03/2014, 21:20

20 695 0
w