... characterization of 2A2 mAb and its Fab fragments 2A2 mAb (41.3 mg) was isolated and purified from hybridoma cell medium Fab fragments prepared by papain degradation of 2A2 mAb were purified by affinity ... concentrated by ultrafiltration The samples were checked for molecular weight and homogeneity by SDS ⁄ PAGE Characterization of 2A2 mAb The IgG subclass of purified 2A2 mAb was determined by indirect ... strong interaction between 2A2 mAb and cathepsin B Determination of the 2A2 mAb binding site on cathepsin B The binding site of 2A2 mAb on cathepsin B was determined by SPOT analysis (SPOTs System;...
Ngày tải lên: 18/02/2014, 11:20
Recent Advances in Gas Separation by Microporous Ceramic Membranes pdf
... RECENT ADVANCES IN GAS SEPARATION BY MICROPOROUS CERAMIC MEMBRANES This Page Intentionally Left Blank Membrane Science and Technology Series, RECENT ADVANCES IN GAS SEPARATION BY MICROPOROUS CERAMIC ... Library o f Congress Cataloging-in-Publication Data Recent advances in gas separation by microporous ceramic membranes / edited by N.K Kanellopoulos. Ist ed p em (Membrane science and technology ... transport membranes for oxygen separation and gas stream enrichment C G Guizard and A C Julbe 435 Gas Separation Applications 4.1 Nanoporous carbon membranes for gas separation S Sircar and M B...
Ngày tải lên: 28/06/2014, 22:20
speech separation by humans and machines
... Date: 2005.09.28 21:10:25 +08'00' SPEECH SEPARATION BY HUMANS AND MACHINES This page intentionally left blank SPEECH SEPARATION BY HUMANS AND MACHINES Edited by Pierre Divenyi East Bay Institute ... recover speech, both by separation and by recognition—a hybrid bottom-up and top-down approach Irino, Patterson, and Kawahara show how speech separation can be achieved by using a combination ... Paris Smaragdis 83 Automatic Speech Processing by Inference in Generative Models Sam T Roweis 97 viii Speech Separation Signal Separation Motivated by Human Auditory Perception: Applica135 tions...
Ngày tải lên: 06/07/2014, 15:29
Báo cáo y học: "Reduced clot strength upon admission, evaluated by thrombelastography (TEG), in trauma patients is independently associated with increased 30-day mortality" potx
... low clot strength, out of patients expired within the first 48 hours from hospital admission (Figure 2) By logistic regression analysis with 30-day mortality as endpoint, reduced clot strength ... http://www.sjtrem.com/content/19/1/52 Page of Table Patients stratified according to clot strength Low clot strength n = 17 Normal or high clot strength n = 72 p-value 43 (32-54) 38 (34-43) 0.38 Males 10 (59%) 49 ... reduced clot strength, had the highest ISS in the cohort (66) and expired on the day of admission Discussion The main finding of the present study was that low clot strength evaluated by TEG was...
Ngày tải lên: 13/08/2014, 23:20
Methane nitrogen separation by pressure swing adsorption
... adsorption equilibrium (equilibrium controlled PSA separation) or by the difference in diffusion rates (kinetically controlled PSA separation) Air separation by PSA using zeolites (CaA, NaX, or CaX) is ... mass of adsorbate adsorbed by adsorbent upto time t, g/g m∞ - mass of adsorbate adsorbed by adsorbent at equilibrium, g/g n - total number of moles of adsorbate adsorbed by adsorbent, mol P - pressure, ... pressure, separation of methane from its mixture with nitrogen by a pressure swing adsorption (PSA) process is likely to enjoy a favorable power cost advantage The main challenge of this separation...
Ngày tải lên: 26/11/2015, 10:50
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation
... secondary sedimentation tank is that its separation ability depends on the operating condition in aeration tanks Therefore, the performance enhancement of CASP by increasing MLSS can only be achieved ... consumption has been done by several researchers Yamamoto [1989] incorporated hollow fiber membrane directly into the suspended solid aeration tank It enabled direct solid-liquid separation without ... with membrane separation was done This experiment was carried out in two sections , namely, preliminary step and main step The preliminary step was the optimization of flux stability by manipulating...
Ngày tải lên: 05/09/2013, 09:08
Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc
... Kir6.2.SUR2A channels is attributable to greater ATP hydrolysis by SUR2B than by SUR2A [6] In this study, we tested this hypothesis explicitly, by measuring the ATPase activity of full-length SUR2A ... SUR2B), and NBD2-DC ATP hydrolysis by NBDs NBD1 and NBD2A displayed higher ATPase activity than NBD2B (Fig 2A; Table 1), with NBD1 having ATPase activity of SUR2A and SUR2B A MBP–SUR2 NBDs 250 ... of ATP hydrolysis by MgADP and beryllium fluoride MgADP inhibited ATP hydrolysis by NBD1, NBD2A and NBD2B with a Ki of 305–443 lm (Fig 4A; Table 2) Inhibition was unchanged by mixing NBD1 and...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt
... novel PP2A heterotrimer IP anti-TIPRL + - - + Anti-PP2Ac PP2Ac Anti-TIPRL TIPRL WCE B Rapa - + IP anti-PP2Ac - - + PP2Ac Anti-PP2Ac α4 Anti-α4 IP anti- α4 WCE C Rapa Anti-TIPRL Anti-PP2Ac Anti-α4 ... PP2Acα α GST His-PP2Acα α His-α4 α + I TIPRL TIPRL + + + + B I B I B I B C Anti- α4 His- α4 His- α4 His-PP2Acα α GST GST fusion GST His-PP2Acα α His-α4 Δ222 α + I PP2Acα α I B I B I B His-PP2Acα ... a novel PP2A heterotrimer J H C Smetana and N I T Zanchin A GST fusion: PP2Acα PP2Acβ α β I B I PP4c B I B PP6c I PP2AcCT B I B GST I B Anti-His GST fusion: PP2Acα/β αβ PP6c PP4c PP2AcCT Coomassie...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo "DETERMINATION SULPHONAMIDES RESIDUES IN FOOD BY HIGH PERFOPvMANCE LIQUID CHROMATOGRAPHY PART 2. SEPARATION AND QUANTIFICATION SULFAGUANIDINE, SULFAMETHOXYPYRIDINE, SULFADOXINE AND SULFAMETHOXAZONE IN ANIMAL FOODSTUFFS AND FOOD PRODUCTS " pdf
... 1159 (2007)233-241 SUMMARY DETERMINATION SULPHONAMIDES RESIDUES IN FOOD BY HIGH PERFOPvMANCE LIQUID CHROMATOGRAPHY PART SEPARATION AND QUANTIFICATION SULFAGUANIDINE, SULFAMETHOXYPYRIDINE, SULFADOXINE ... ciia Bd Thuy san Ming-Ren S Fuh, Su-Yi Chu - Quantitative determination of sulfonamide in meat by solid-phase extraction and capillary electrophoresis, Analytica Chimica Acta 499 (2003) 215-221 ... of an RP-C18 analytical column with a mobile phase at pH = 4,5 enabled excellent chromatographic separation and quantification of sulfadoxine (SDO), sulfaguanidine (SGU), sulfamethoxypyridine (SMP)...
Ngày tải lên: 20/03/2014, 21:20
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot
... containing Sp1- or AP -2a- binding sites in the KCTD10 promoter was precipitated by antibodies against Sp1 or AP -2a but not by control IgG, indicating that endogenous Sp1 or AP -2a proteins specifically ... +30)-F5 P ()13 ⁄ +30)-F6 P ()609 ⁄ )241)-R AP -2a ⁄ chipF AP -2a ⁄ chipR Sp1 ⁄ chipF Sp1 ⁄ chipR AP -2a ⁄ si Sp1 ⁄ si KCTD10FP KCTD10RP Sp1FP Sp1RP AP-2aFP AP-2aRP b-actinFP b-actinRP CCAAGCTTCGGACTGAGAGAGGCAGGAA ... dose-dependent manner AP -2a silencing increased the expression of endogenous KCTD10 by 2.3-fold, whereas AP -2a overexpression decreased the expression of endogenous KCTD10 by 5.6-fold AP -2a is a negative...
Ngày tải lên: 30/03/2014, 02:20
Separation of acetic acid and water by distillation effect of calcium chloride addition
... DAT-4 FOR ACETIC ACID-WATER-CALCIUM L O R I D E SYSTEM CH (Pressure, 760 mm €Ig) m't % R u n No 1A 2A 3E 4A 5A 6A 10 11 12 13 14 15 25 Figure 50 TEMPERATURE, 16 17 18A 19 20 21 22 23 25A 26 27 28 ... used as the contact fluid The thermometer was checked and found to be accurate at the 100' C point by making a trial run with distilled water The experimental runs were designed t o cover the complete ... chloride concentrations varying from zero to the maximum possible value, this limit being determined by the solubility of the salt in the liquid Be- 33 34 36 37 38 39 40 ~~~ ~ S 0.0 0.0 0.0 0.0 0.0...
Ngày tải lên: 05/05/2014, 08:42
Báo cáo hóa học: " Research Article Query-by-Example Music Information Retrieval by Score-Informed Source Separation and Remixing Technologies" potx
... The experimental result showed that the separation performance for predictable feature shifts depends on an instrument part Query -by- Example Retrieval by Remixed Musical Audio Signals In this ... 1 √ exp − = f + κ log β 2π (14) 3.2 Iterative Separation Algorithm The goal of this separation is to decompose X(t, f ) into each (k, l)th note by multiplying a spectrogram distribution function, ... classification shift caused by changing the volume of vocal and guitar (b) Genre classification shift caused by changing the volume of vocal and drums (c) Genre classification shift caused by changing the...
Ngày tải lên: 21/06/2014, 07:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_1 pot
... machinability, a function of the tensile strength, • Finishability, or ease of obtaining a good finish, • Abrasiveness, or the abrasion undergone by the tool during cutting.’ By 1950, Boulger had summarised ... sub-surface damage caused by the cutting edge By 1989, Smith made the point that in fact machinability, had to address these properties and the word ‘metal’ should be substituted by the expression ‘material’ , ... ease of producing satisfactory products by chip-forming methods.’ Even these definitions still lack sufficient precision to be of much practical use and by 1999, Gorzkowski, et al., in their powder...
Ngày tải lên: 21/06/2014, 22:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_2 docx
... speed was raised by >2.5 times the optimum of 200 m min–1, with all facing operations being conducted at a ‘constant surface speed’12 of 550 m min–1 Typical tool-life curves produce by the AWT technique ... surface speed’ , this can be achieved by employing the appropriate ‘canned-cycle’ G-code accessed from the CNC controller, which allows the testpiece’s rotational speed to increase as the faced ... increase as the faced diameter decreases* * Normally there is a restriction on the rotational speed limit – created by the maximum available speed for this machine tool, which would normally be reached...
Ngày tải lên: 21/06/2014, 22:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_4 pot
... pre-stressed by applying loads by the application of either: tension-, or compression-shimming However, as the pitch of any the screw has minute errors present, these are usually ‘mapped-out’ by the ... knowledge of material stiffness and cutting system dynamics • Rotational speed – is probably the simplest parameter to modify, thereby altering chatter and its associated amplitude, NB The peripheral ... capacity Further, machining stability can be increased by utilising tooling with the greatest possible diameter with the minimum of tool overhang By way of a caution concerning chatter frequency,...
Ngày tải lên: 21/06/2014, 22:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_5 pdf
... sampling length Reliability of the data is enhanced by taking an average of the sampling lengths as depicted by the evaluation length shown in Fig 1 62a Most of today’s stylus-based surface texture ... the profile as a function of level More specifically, by plotting the bearing ratio at a range of depths in the profile trace, the manner by which the bearing ratio changes with depth, provides ... automotive cylinder bores in volume production by the manufacturing industry Today, Rpk, Rk and Rvk are employed across a much more diverse-field by a range of industries Such hybrid parameters...
Ngày tải lên: 21/06/2014, 22:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_7 ppt
... deformation zone where it is heated-up until it leaves this zone, it is then swept-away by the formed chip Equally point ‘Y’ , passes through both the primary and secondary deformation zones (i.e ... detail, was that conducted and described by Tay (1993), where he experimentally-obtained information regarding: velocity, strain and strain-rate distributions, by utilising a printed-grid and quick-stop ... been spent by both researchers and tooling companies, ensuring that tool wear mechanisms and their respective classifications for specific machining operations are understood So, by knowing the...
Ngày tải lên: 21/06/2014, 22:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_8 doc
... tensile strength of 1400 N mm–2) For Cast steel/iron: Endurance limit = 0.45 tensile strength (i.e up to tensile strength of 600 N mm–2), Endurance limit = 275 N mm–2 (i.e above a tensile strength ... limit’ being about half its tensile strength, with an approximation often utilised: For steels: Endurance limit = 0.5 tensile strength (i.e up to a tensile strength of 1400 N mm–2), Endurance ... insert notching when only the surface is ‘skimmed’ by a longitudinal turning operation • Notch wear on insert’s trailing edge – occurs by in the main, by adhesion wear, but to a lesser extent, may...
Ngày tải lên: 21/06/2014, 22:20
Machining of High Strength Steels With Emphasis on Surface Integrity by air force machinability data center_9 docx
... accurately measured by a dial gauge located across the centre of the internal portion of the proving-ring’s diameter Changes in the dial gauge readings, can be converted to force measurement by means of ... generated by a pre-loaded bolt This act of preloading the system is absolutely essential and is usually undertaken when the force transducer is initially installed into the dynamomoter by the manufacturer ... minute, then after this time, the result of the measurement can only be invalidated by a maximum ±0.6 N, that is by ±0.006% Hence, it is a simple task to piezoelectrically measure large forces for...
Ngày tải lên: 21/06/2014, 22:20