... Balachandran I, Walker JW Jr, Broman J: Fine needle aspiration cytology of ALK 1(-), CD 30(+) anaplastic large cell lymphoma post renal transplantation: A case report and literature review Diagn ... loss, headaches and fever A lumbar puncture was negative for infection or lymphoma Cranial imaging with a computed tomography (CT) scan was also negative An esophagogastroduodenoscopy (EGD) was performed ... as: Ratuapli et al.: Epstein Barr Virus- positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report Journal of Medical Case Reports 2011...
Ngày tải lên: 11/08/2014, 02:22
... For radiotracer assays, protein was measured by the bicinchoninic acid assay [25] with bovine serum albumin as standard The protein content of MS samples was estimated from the response ratio ... Grundemann ¨ unpublished results) For pEBTet ⁄ SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC ... which was calibrated against the bicinchoninic acid assay (4–6 matched cell dishes) for each MS session Northern blot analysis Northern analysis was performed with 33P-labelled doublestranded DNA...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo y học: "Epstein–Barr virus and rheumatoid arthritis: is there a link''''" docx
... Sukpanichnant S, Chongvisal S, Metheetrairat C, Kositanont U, Puthavathana P: Specific IgA antibody to Epstein- Barr viral capsid antigen: a better marker for screening nasopharyngeal carcinoma ... AK, Kaur J: Antioxidant status in rheumatoid arthritis and role of antioxidant therapy Clin Chim Acta 2003, 338:123-129 Kamanli A, Naziroglu M, Aydilek N, Hacievliyagil C: Plasma lipid peroxidation ... antibodies against EBV viral capsid antigen (VCA) and early antigen complex – diffuse (EA-D) appear [45,66] Later, weeks to months after disease onset, antibodies against EBV nuclear antigen (EBNA) and...
Ngày tải lên: 09/08/2014, 07:20
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... remission; AST: aspartate aminotransferase; ALT: alanine aminotransferase; CMV: cytomegalovirus; HTLV-1: human T-cell lymphotropic virus type 1; HIV: human immunodeficiency virus; VCA: anti -Epstein- Barr ... (Figure 1A) , and a diagnosis of AML-MLD was made based on World Health Organization (WHO) criteria [4] The immunophenotype of blasts was CD7, 13, 33, 34, and HLA-DR positive, and an abnormal karyotype, ... Hoshida Y, Xu JX, Fujita S, Nakamichi I, Ikeda J, Tomita Y, Nakatsuka S, Tamaru J, Iizuka A, Takeuchi T, Aozasa K: Lymphoproliferative disorders in rheumatoid arthritis: clinicopathological analysis...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx
... 96:443-451 Kasahara Y, Yachie A, Takei K, Kanegane C, Okada K, Ohta K, Seki H, Igarashi N, Maruhashi K, Katayama K, Katoh E, Terao G, Sakiyama Y, Koizumi S: Differential cellular targets of Epstein- Barr ... patient care and provided clinical information; AG, CM, SR, and MTS analyzed data; SAP and PPP performed research, analyzed data and wrote the manuscript All authors read and approved the final ... http://www.jmedicalcasereports.com/content/5/1/218 Authors’ contributions VT performed research, analyzed data and wrote the manuscript; CA performed research and analyzed data; ES and FB analyzed data; SC and...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: "Primary effusion lymphoma associated with Human Herpes Virus-8 and Epstein Barr virus in an HIV-infected woman from Kampala, Uganda: a case repor" pptx
... Tumwine et al.: Primary effusion lymphoma associated with Human Herpes Virus- 8 and Epstein Barr virus in an HIVinfected woman from Kampala, Uganda: a case report Journal of Medical Case Reports 2011 ... nucleoli, and varying amounts of vacuolated cytoplasm There were immunoblastic, plasmablastic and anaplastic variants with bizarre, pleomorphic nuclei (Figure 1A) They included multinucleated and Reed-Sternberg-like ... 1989 as a subset of body-cavity-based lymphomas [1,2] It accounts for only 0.13% of all AIDS related malignancies among AIDS patients in the USA [3] The WHO classification recognizes it as a unique...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye" pps
... plasma of nasopharyngeal carcinoma and lymphoma patients Cancer Res 2003, 63(9):2028-32 43 Lin JC, et al: Quantification of plasma Epstein- Barr virus DNA in patients with advanced nasopharyngeal ... AGC AAA TAT ATG AG 554 bp N /A Custom 95°C initial denaturation for 10 mins; 55°C annealing BG-1F TAG CAA CCT CAA ACA GAC ACC A 247 bp BG-1R BHRF-1 Amplicon Length CAG CCT AAG GGT GGG AAA AT EB-R ... Target Primer Name Oligonucleotide Sequence 5’-3’ EBNA-1 QP1 GCC GGT GTG TTC GTA TAT GG QP2 CAA AAC CTC AGC AAA TAT ATG AG EA-1F GGA GAT ACT GTT AGC CCT G EA-2R GTG TGT TAT AAA TCT GTT CCA AG...
Ngày tải lên: 12/08/2014, 01:22
epstein-barr virus protocols
... EBV-Encoded Small RNAs The small RNAs of EBV, EBER-1 and -2, the VA RNAs of adenovirus, and many small cellular RNAs such as the Y or U RNAs have complex and highly stable secondary structures As a result ... primer pair: 5'-GTCAGCCGCCAGGGTCCGTTTA-3'/5'-AAGTTTCC-TTG CCATCTAAAGC-3' CAM primer pair: 5'-TTCTGCCGACATGGAAGCCATC-3'/5'-GGAGTGAATA-CCA CGACGATTTCC-3' Whole sheep blood (Oxoid GmbH, Wesel, Germany) ... denaturants including formamide, glyoxal/DMSO (27) and urea By far the easiest and safest method is the use of urea as a denaturant and anyone familiar with DNA or RNA sequencing or RNA mapping...
Ngày tải lên: 10/04/2014, 22:31
báo cáo hóa học:" Clinical values of multiple Epstein-Barr virus (EBV) serological biomarkers detected by xMAP technology" potx
... carcinoma (NPC) in south China and Southeast Asia [8], Burkitt's lymphoma (BL) in equatorial Africa and Papua New Guinea [9], nasal NK/Tcell lymphoma in Asia and Latin American [10] Generally, ... Sugiura M, Tokunaga M, Uemura Y, Yamamoto N, Tanaka S, Sato E, Osato T: Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein- Barr virus latent infection protein Proc Natl Acad ... pathogenesis of a virus- associated malignancy Hematology Am Soc Hematol Educ Program 2007, 2007:277-284 Aozasa K, Takakuwa T, Hongyo T, Yang WI: Nasal NK/T-cell lymphoma: epidemiology and pathogenesis...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Epstein-Barr virus encoded latent membrane protein 1 regulates mTOR signaling pathway genes which predict poor prognosis of nasopharyngeal carcinom" pot
... (AP-1) and employing Janus kinases (JAKs) or and signal transducers and activators of transcription (STATs) (JAK/STAT) pathways and regulate their substrates[6] LMP1 also targets the phosphatidylinositol-3-kinase ... extracelluar signal-regulated kinase/mitogen-activated protein kinase (ERK-MAPK) pathway [9] Mammalian target of rapamacin (mTOR) is an evolutionarily conserved serine/threonine protein kinase with an ... gastric cancer British journal of cancer 2009, 100(5):782-788 27 Faried LS, Faried A, Kanuma T, Aoki H, Sano T, Nakazato T, Tamura T, Kuwano H, Minegishi T: Expression of an activated mammalian...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: "Epstein-barr virus induced cellular changes in nasal mucosa" pptx
... endonasal neoplasms commonly affecting the middle turbinate or the ostio-meatal complex are nearly always benign (nasal polyps), secondary to vasomotor rhinopathies (NARES, nasal mastocytosis), and ... secondary to allergic or inflammatory rhinopathies (antro-coanal polyps) Only a very small percentage (3%) are malignant (inverted papilloma, leiomyosarcoma, nasopharyngeal carcinoma) [18,20] In addition ... lymphoma and nasopharyngeal carcinoma (NPC), or Epstein- Barr virus (EBV) [1012] The case described below focuses on specific microscopic and ultrastructural alterations in the nasal mucosal cells...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Secretion of Epstein-Barr Virus-encoded BARF1 oncoprotein from latently infected B cells" doc
... (IB4 and AKATA) and BARF1-negative Raji cell line To purify secreted BARF1 protein, the concentrated medium was incubated with concanavalin A- ag at room temperature, then concanavalin A- ag was washed ... concentration) As BARF1 protein has affinity for agaroseconjugated concanavalin A [20,21], concentrated culture medium was purified with Concanavalin A Affinity purified BARF1 protein was analyzed ... Fukayama M, Eizuru Y, Ooka T, Takada K: Epstein- Barr virus (EBV)-encoded BARF1 gene is expressed in nasopharyngeal carcinoma and EBV-associated gastric carcinoma tissues in the absence of lytic gene...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx
... CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT TATCAAATTCAAGTGAAT TATCTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCT GAACTGTAGCTGATGTTAT ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGA CTAACCCTGTTCCCAGAGCC ... TTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAG CCCCTGAACTTCCACGCCA GCAAGAAGTTACGACACGTACACAACGACAGAACAACAGAGAAGACCCCG AAGACCACTAGCACGACCGT CGAAGGAAAGTGGAGCTCTTCATCGCCACCTCCCAGAAGTTTATCCAGGAG ACAGAGCTGAGCCAGCGCA CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT ... TCATCCAGACTTAGCCAC GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA ACCTTGGCCATCTATGACCTGGCTACGCAGACTCTTAGGCATCAGTGTCAG CACCAGTCGGGCATCGTGC TTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCC...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:"Epstein-barr virus induced cellular changes in nasal mucosa" docx
... endonasal neoplasms commonly affecting the middle turbinate or the ostio-meatal complex are nearly always benign (nasal polyps), secondary to vasomotor rhinopathies (NARES, nasal mastocytosis), and ... secondary to allergic or inflammatory rhinopathies (antro-coanal polyps) Only a very small percentage (3%) are malignant (inverted papilloma, leiomyosarcoma, nasopharyngeal carcinoma) [18,20] In addition ... lymphoma and nasopharyngeal carcinoma (NPC), or Epstein- Barr virus (EBV) [1012] The case described below focuses on specific microscopic and ultrastructural alterations in the nasal mucosal cells...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Patients with systemic lupus erythematosus have abnormally elevated Epstein–Barr virus load in blood" pps
... analyzed on an image analysis system (Amersham Pharmacia Biotech) Results obtained from serially diluted Namalwa cells were used to prepare a standard curve The density of each sample was measured ... GGCTGATATGGAATGTGCCC EBNA-2 EBNA-3B EBNA, Epstein Barr virus nuclear antigen subjected to electrophoresis on a 2% agarose gel Southern transfer onto a Hybond-N+ nylon membrane (Amersham Pharmacia ... individuals by direct PCR analysis of mouthwash samples We also compared EBV loads in blood between SLE patients and healthy control individuals using a semiquantitative PCR assay Materials and methods...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx
... only available for 16 out of 29 cases €Data was only available for 38 out of 39 cases ∂The data was only available for 36 out of 39 cases ΩData was only available for 26 out of 30 cases ΨData was ... only available for 31 out of 34 cases ¥Data was only available for 28 out of 29 cases ∞Data was only available for 26 out of 29 cases ØData was only available for 27 out of 29 cases ¤Data are ... only available for 28 out of 30 cases θData was only available for 18 out of 30 cases for NPC plasma samples Data was only available for 31 out of 32 cases for NPC tissues ΦData was only available...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo y học: "Effect of methotrexate and anti-TNF on Epstein-Barr virus T-cell response and viral load in patients with rheumatoid arthritis or spondylarthropathies" ppt
... JP, Sokal EM: Ratio between Epstein- Barr viral load and anti-EpsteinBarr virus specific T-cell response as a predictive marker of posttransplant lymphoproliferative disease Transplantation 2002, ... Saint-Quentin Fallavier, France) Statistical analysis Results are given as the percentage of patients with positive EBV T-cell response, as well as the mean response ± standard deviation Statistical analyses ... collection, manuscript preparation, interpretation of data and statistical analyses NG performed the ELISPOT assays and statistical analyses CA performed the EBV quantitative PCR JS, MI and SP contributed...
Ngày tải lên: 09/08/2014, 14:21
Báo cáo y học: "Possible roles of Epstein-Barr virus in Castleman disease" potx
... Castleman disease More EBV-positive cells in germinal centers are associated with increased vascularity and smaller tumor size EBV may play a role of angiogenesis in early stage of Castleman Disease ... in Castleman's disease Blood 1989, 74:1360-7 Yokoi T, Miyawaki T, Yachie A, Kato K, Kasahara Y, Taniguchi N: Epstein- Barr virus- immortalized B cells produce IL-6 as an autocrine growth factor ... extent of vascularity of each case are listed in table We excluded one case of plasma cell type when we compare the localization of EBV and the extent of vascularity because it lacks vascular component...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Compressive stenosis of the left hepatic vein as a pathogenesis of postresectional liver failure: a case report" potx
... al., hepatic venous stenoses after liver transplantation were treated favorably by balloon angioplasty, although repeat angioplasty was necessary against restenosis [13] The main cause of anastomotic ... 75:1561-1564 Urata K, Kawasaki S, Matsunami H, Hashikura Y, Ikegami T, Ishizone S, Momose Y, Komiyama A, Makuuchi M: Calculation of child and adult standard liver volume for liver transplantation Hepatology ... after liver transplantation is thought to be a fibrosis or intimal hyperplasia around the anastomotic site However, stenosis after partial hepatectomy seems to be attributable, at least in part,...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Genome-wide analysis of host-chromosome binding sites for Epstein-Barr Virus Nuclear Antigen 1 (EBNA1)" pot
... similar the new consensus G [A/ G][T/C]AGcATaTGCTaCC derived by Dresang et al using 70 viral and cellular binding sites [17] In a separate study, Canaan et al identified GaA[G /A] TAT[T/C] as a consensus ... this study cactcaagcttcaatggcctaggagagaagggagacacatc) into the pENTR/D-Topo vector (Invitrogen) Chromatin immunoprecipitation (ChIP) Assays Methods Cells and Plasmids Raji cells (human EBV positive ... that have fold ration > 10 and peak score > and p value < 0.001 (as determined by Poisson background model) are considered as statistically significant Peak score is calculated as the average value...
Ngày tải lên: 12/08/2014, 01:22