epithelial mesenchymal transition in nitrofen induced pulmonary hypoplasia in congenital diaphragmatic hernia a pilot study
Báo cáo y học: " Effects of PPARg ligands on TGF-b1-induced epithelial-mesenchymal transition in alveolar epithelial cells" ppsx
Ngày tải lên :
12/08/2014, 11:20
... monoclonal antibodies against human E-cadherin and N-cadherin were from BD Transduction Laboratory (Oxford, UK), against human b-actin from Abcam (Cambridge, UK) and against human aSMA from Sigma Aldrich ... TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT) Respir Res 2005, 6:56 14 Ranganathan P, Agrawal A, Bhushan R, Chavalmane AK, Kalathur RK, Takahashi T, Kondaiah P: ... chemicals and reagents from Sigma Aldrich Cell Culture and Drug Treatment Human type II alveolar epithelial cell line A5 49 (ATCC, Manassas, VA) was maintained in high glucose-DMEM (Invitrogen, Carlsbad,...
- 13
- 242
- 0
Epithelial mesenchymal transition in breast cancer progression
Ngày tải lên :
05/10/2015, 21:24
... Specifically, EMT induces a phenotypic, molecular and behavioural change in carcinoma cells, permitting them to invade and metastasise In our study on breast cancer tissue using microarray analysis ... SPARC staining intensities in 30 cases of breast carcinoma 95 Table 10 Observed frequency of SPARC staining intensities in the surrounding stromal cells in 30 cases of breast carcinoma 95 Table ... maspin staining intensities in 30 cases of breast carcinoma 116 Table 15 Correlation between maspin positivity and clinicopathological variables in invasive ductal carcinoma of the breast 117 ...
- 161
- 480
- 0
báo cáo hóa học: " Body mass index and health related quality of life in elementary school children: a pilot study" pdf
Ngày tải lên :
18/06/2014, 19:20
... provided guidance on using SF-10 for Children TM related to data collection and analysis TK managed the database and did data entry All authors read and approved the final manuscript Acknowledgements ... social, mental and emotional determinants of health are of interest Health indices are useful in health policy and economic evaluation, because a single score is useful in making choices and ... Medicare and Medicaid Services and the National Committee for Quality Assurance's Health Plan Employer Data Information Set (HEDIS 3.0) to evaluate the quality of care that is provided in managed...
- 6
- 416
- 0
báo cáo hóa học: "Effect of step-synchronized vibration stimulation of soles on gait in Parkinson''''s disease: a pilot study" doc
Ngày tải lên :
19/06/2014, 10:20
... including spinal circuitry and basal ganglia Supporting this notion are functional magnetic resonance imaging studies that have demonstrated activation of distinct brain structures when vibration ... including postural instability and gait impairment Short shuffling steps, slow walking speed, and increased stride variability characterize abnormal gait in PD Although PD is primarily a motor ... state LEDD = the levodopa equivalent daily dose Background Parkinson's disease (PD) is caused by a dopamine deficiency in the basal ganglia that results in characteristic motor abnormalities including...
- 7
- 497
- 0
báo cáo hóa học:" Dynamic magnetic resonance imaging in assessing lung function in adolescent idiopathic scoliosis: a pilot study of comparison before and after posterior spinal fusion" doc
Ngày tải lên :
20/06/2014, 01:20
... Figure Measurement of diaphragmatic heights on the reformatted coronal image Measurement of diaphragmatic heights on the reformatted coronal image (a) At maximal inspiratory image and (b) maximal expiratory ... reformatted axial image Measurement of AP and TS diameter of the chest wall on the reformatted axial image (a) Upper level at the carina (C), maximal inspiratory image (b) Lower level at the apical vertebra ... expiratory image The diaphragmatic heights were taken as the vertical distance in between the line drawn tangent to the highest point of the diaphragm and a parallel line to the lung apex The diaphragmatic...
- 7
- 410
- 0
Báo cáo khoa học: "rimary care patients in psychiatric clinical trials: a pilot study using videoconferencing" pps
Ngày tải lên :
08/08/2014, 23:20
... clinical trials An obstacle to participation in clinical depression trials by primary care physicians is the lack of formal training in the diagnosis and assessment of depression using standardized ... current study examined the feasibility of identifying, recruiting and screening primary care patients for clinical trials, and examined patient comfort, satisfaction, and adherence in a mock clinical ... telephone and face-to-face interviews in assessing axis I and II disorders American Journal of Psychiatry 1997, 154:1593-1598 Pinto-Meza A, Serrano-Blanco A, Penarrubia MT, Blanco E, Haro JM: Assessing...
- 6
- 395
- 0
Báo cáo khoa học: "nalgesic Effect of Meloxicam in Canine Acute Dermatitis – a Pilot Study" ppsx
Ngày tải lên :
12/08/2014, 15:20
... registrerades på en visuell analog skala (VAS) innan administrering av substans Detta upprepades under de följande 2-3 dagarna Alla hundar gavs cefalexin oralt De hundar som gavs meloxicam och cefalexin ... thromboxane A2 (TxA2) formation and COX-2 mediates in ammatory responses Meloxicam has analgesic, anti -in ammatory, antipyretic and anti-exudative effects After subcutaneous administration a maximum plasma ... Sudmann E, Marton PF: Effect of indomethacin on fracture healing in rats Acta Orthop Scand 1976, 47, 588-599 Engelhardt, G, Homma D, Schlegel K, et al: Anti -in ammatory, analgesic, antipyretic and...
- 6
- 223
- 0
Báo cáo khoa học: " Early decompressive craniectomy and duraplasty for refractory intracranial hypertension in children: results of a pilot study" ppsx
Ngày tải lên :
12/08/2014, 19:22
... surgical treatment (decompressive craniectomy) Table Basic clinical data and course in study infants Age Patient (years) Sex Type of trauma Glasgow Coma Scale Peak ICP on admission (mmHg) Initial ... 70 Unilateral skull fracture; brain contusion in frontal lobe, basal ganglia and corpus callosum (DAI) Bilateral 11 11 Male Car accident 41 Left-sided calvarial and skull base fracture, tSAH, DBS ... treatment strategy in pediatric head injury [6] The presented pilot trial adds an additional argument for surgical decompression at an early stage in case of treatment-refractory intracranial...
- 6
- 282
- 0
Báo cáo y học: "Chiropractic manipulation in Adolescent Idiopathic Scoliosis: a pilot study" docx
Ngày tải lên :
13/08/2014, 14:20
... aa = African American, c = Caucasian; Family History = family history of scoliosis, medical = standard medical care, sham = standard medical care plus sham manipulation, chiropractic = standard ... that was rated as a failure; the standard medical care plus sham manipulation patient had both curves rated as failures; and the standard medical care plus chiropractic manipulation group had ... Exclusion criteria • Age 16 years • Diagnosis other than AIS following clinical, radiographic and advanced imaging assessment • Contraindications to manipulation: inflammatory arthritides,...
- 10
- 317
- 0
Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx
Ngày tải lên :
12/08/2014, 16:20
... NY, USA) using the following primers: forward 5'GAAGATCTATGCCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGAC-3' and reverse 5'-CGGAATTCTGAACAAACGACCCAAC-3' The PCR product was then sub-cloned into the BamHI-EcoRI ... collagen deposition around the walls of small veins and terminal respiratory bronchioles and in certain parenchymal areas (Fig 3A~ j arrowheads) In contrast, there is only minimal βgal staining ... control (a) Mesenchymal marker F-actin, was faintly stained at the cell margin in the control (c), whereas the staining was substantially enhanced and abundantly located throughout cytoplasm after...
- 11
- 433
- 0
Runx3 protects gastric epithelial cells against epithelial mesenchymal transition induced cellular plasticity and tumorigenicity
Ngày tải lên :
09/09/2015, 18:57
... of each dNTP (Finzymes, Espoo, Finland), 0.4µM of forward primer (5’-AAAAAAGAATTCATGCGTATTCCCGTA GACCCAAGCACCAGC-3’) and 0.4µM of reverse primer (5’-AAAAAAGCGGCC GCTCAGTAGGGCCGCCACACGGCCTCATCC-3’) ... non DNAbinding partner, core-binding factor β (CBFβ) (Kamachi et al., 1990) Although the Runt domain can bind DNA independently, its binding affinity and hence transcriptional activity is greatly ... pathway 1.3.2 RUNX3 attenuates the oncogenic Wnt signaling pathway In mammals, the canonical Wnt pathway is critical in cell fate determination in embryogenesis and orchestrates self-renewal in...
- 172
- 201
- 0
Báo cáo y học: "Relevance of the stroma and epithelial-mesenchymal transition (EMT) for the rheumatic diseases" docx
Ngày tải lên :
09/08/2014, 08:22
... hepatocellular carcinoma cell invasion by upregulating Snail and Slug, down regulating E-cadherin, translocating β-catenin into nuclei, and inducing dramatic spreading and morphological changes in the cancer ... grade and stage and inactivating mutations of E-cadherin are present in 50% of lobular breast carcinomas [18,19] Equally important are E-cadherin repressors In a very influential paper, Yang and ... Giannelli G, Bergamini C, Fransvea E, Sgarra C, Antonaci C: Laminin with transforming growth factor-beta induces epithelial to mesenchymal transition in hepatocellular carcinoma Gastroenterology...
- 11
- 622
- 0
PRL 3 promotes epithelial mesenchymal transition and confers resistance to apoptosis
Ngày tải lên :
16/10/2015, 15:37
... coordinated activities of protein kinases and protein phosphatases Protein phosphatases can be classified as Protein Ser/Thr Phosphatases and Protein Tyrosine phosphatases (PTPs) Initially, it was ... Ala are catalytically inactive and mutants of Asp to Ala are substrate trapping mutants that retain the ability to bind substrates but also have lowered catalytic function [30] The substrates ... molecules in integrin-mediated signalling pathways such as FAK, paxillin and p130CAS [24] Src is mainly activated by the dephosphorylation of negative regulatory tyrosine 527 Increased Src activity has...
- 74
- 283
- 0
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"
Ngày tải lên :
26/10/2012, 09:57
... 2001;41:604-5 Prakash S, Chavda BV, Mandalia H, Dhawan R, Padmanabhan D Headaches related to triptans therapy in patients of migrainous vertigo J Headache Pain 2008;9(3):185-8 Marcus DA, Furman JM Prevention ... sickness in migraine sufferers Headache 2005;45(6):653-6 Drummond PD, Granston A Facial pain increases nausea and headache during motion sickness in migraine sufferers Brain 2004;127(Pt 3):526-34 Brandt ... Female Female Female Female Female Female Female Aura Aura No Aura Aura Aura Aura Aura Vertigo Vertigo Non-Vertigo Non-Vertigo Vertigo Vertigo Non-Vertigo Motion Sickness History Actual Visual...
- 6
- 504
- 0
Báo cáo khoa học: "Prevention of radiochemotherapy-induced toxicity with amifostine in patients with malignant orbital tumors involving the lacrimal gland: a pilot study" pps
Ngày tải lên :
09/08/2014, 09:22
... cornea and adjacent exposed bulbar conjunctiva was graded using a 0–3 scale resulting in a total staining score Abnormal staining (fluorescein and rose bengal) was classified as greater than or ... orbital and nasal cavity There were also large osseous destructions of the lamina cribrosa and the medial orbital and maxillar sinus walls Histopathological findings confirmed the diagnosis of a malignant ... 51% In another comparative study in 50 patients with mainly naso-oro-pharyngeal tumor localization, Antonadou et al have shown considerable reduction of acute (mucositis and dysphagia) and late...
- 6
- 261
- 0
Báo cáo y học: "An experimental model of rhinovirus induced chronic obstructive pulmonary disease exacerbations: a pilot study" pps
Ngày tải lên :
12/08/2014, 16:20
... tive load measured ViralRT-PCR assay with measured with a real-time quantitaViral load measured with measured with a real-time quantitative RT-PCR assay Viral load was significantly increased above ... many obstacles that investigators face in studying naturally occurring exacerbations including under-reporting of exacerbations[5], delay in presentation[30], varying aetiology, difficulties in ... inoculum was instilled Nasal lavage Nasal lavage was performed by instilling 2.5 mL of 0.9% saline into each nostril, holding for seconds and then expelling into a sterile container Samples were...
- 10
- 320
- 0
THE SIMPLE SENTENCE IN TRADITIONAL GRAMMAR AND THE CLAUSE SIMPLEX IN SYSTEMIC FUNCTIONAL GRAMMAR a COMPARATIVE STUDY
Ngày tải lên :
07/09/2013, 13:48
... grammar was originally articulated by M .A. K Halliday in the 1960s and has now come to be recognized as a major force in linguistics Halliday, in Introduction to Functional Grammar, explains that ... participant is the Sayer the participant saying, telling, stating, informing, asking, demanding, offering, threatening, suggesting and so on, The Sayer can be a human or human-like speaker, and also ... in general and on language teaching in particular in several parts of the world, including Vietnam For a long time, sentence has been the main content of grammar teaching at schools As a result,...
- 59
- 1.1K
- 13
Women''''s autonomy in household decision-making: a demographic study in Nepal potx
Ngày tải lên :
05/03/2014, 15:20
... interests Authors' contributions DRA and PS jointly developed the principal idea for the analysis DRA and JSB obtained the data and did the statistical analysis DRA further analysed, reviewed and drafted ... role in shaping a wife's decisionmaking authority and is even more important than other individual-level characteristics as a determinant of authority [11] Another study emphasises that compared ... participation and household decision making in Nepal, a working paper (526) for the World Bank, Washington DC 1983 Senarath U, Gunawardena NS: Women's autonomy in decision making for health care...
- 12
- 543
- 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
Ngày tải lên :
08/03/2014, 16:20
... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACAGTTTAGCTCGGTACC CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT ... CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT named according to the amino-acid residues substituted by alanine and their respective position in the polypeptide...
- 7
- 404
- 0
the implementation and adopting of activity based costing in manufacturing vietnamese companies a case study of samsung vina corporation
Ngày tải lên :
13/03/2014, 14:20
... proportion than indirect 4.1.3 Estimating the accounting system of Savina After having analyze about accounting system information of Savina, the advantages and disadvantages are below The outstanding ... related services was calculated inaccuracy by the costing systems This led to the decisions making based on the inaccuracy information of managers was also increased ABC investigates cause and ... remains costly to maintain Savina want to follow ABC need to maintain two cost systems and accounting books, one for internal use and another for external reports, filings, and statutory compliance,...
- 64
- 1.4K
- 3