energy efficiency projects may be less attractive than core business projects
A WORLD BANK STUDY Green Infrastructure Finance
Ngày tải lên :
29/08/2016, 08:30
... Low-Emission Projects Are Not Ge ing Financed? 23 Figure 3: Project Finance for a Power Plant 26 Figure 4: Energy Efficiency Projects May Be Less A ractive than Core Business Projects ... production: see Figure 4) 30 World Bank Study Figure 4: Energy Efficiency Projects May Be Less Attractive than Core Business Projects Source: Authors Moreover, EE investments, like their more capital ... would be expended first on the lowest abatement cost projects, then on higher abatement cost projects, until resources were exhausted All projects below a certain level of abatement cost would be...
- 76
- 231
- 0
REASONS WHY HORMONES ARE NOT USED IN THE POULTRY INDUSTRY ppt
Ngày tải lên :
17/03/2014, 10:20
... way as the corn or soybean meal that they eat The only way for a growth hormone to be effective would be to inject it everyday in the same manner as Insulin is to treat diabetes Logically speaking ... being a good neighbor, it may be a good idea to at least talk with them and let them know that if they continue to as they have done in the past,,, all of the poultry producers will wind up being ... mortality rate This would be highly counter productive The hormones which may enhance growth are actually proteins Therefore, if they were consumed in the feed they would be digested in the same...
- 5
- 1.3K
- 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
Ngày tải lên :
10/08/2014, 23:21
... has been reported in 20-25% of patients with PJS, and a risk of cancer in other organs has been also reported, including the ovary, breast, bladder, pancreas and thyroid [2,19-22] To the best ... type hamartomatous polyps have been considered as a separate clinical entity from PJS However, Case in our report had duplicated malignancy in six organs An overlap between solitary Peutz-Jeghers ... in six organs An overlap between solitary Peutz-Jeghers type hamartomatous polyps and PJS may need to be reexamined Our two cases were diagnosed in patients with an advanced age similar to previous...
- 4
- 458
- 0
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
Ngày tải lên :
21/12/2013, 19:15
... network address of the network that is going to be reached must be known The IP address of the next router on the path to this destination must be known as well Moscow#configure terminal Moscow(config)#ip ... information must be configured to specify the remote name of the remote router in the Dialer Profile The dial string, or phone number to use to contact this remote device must also be specified Use ... Router(config)#reload The responding line prompt will be: System configuration has been modified Save? [yes/no]: Type n and then Enter The responding line prompt will be: Proceed with reload? [confirm] Press...
- 8
- 419
- 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc
Ngày tải lên :
20/02/2014, 02:21
... and immediately benzoylated, as described by Blank et al [32] Diradylglycerobenzoates were separated into their subclasses (diacyl, alkylacyl, and alk-1enylacyl types) by TLC using benzene/hexane/ether ... [32P]ATP[cP], as described by Preiss et al [31] The manufacturer’s instructions for the commercially available DAG test kit were followed 32P-labelled PA was purified using chloroform/methanol/acetic acid ... Experiments were performed between 09.00 h and 11.00 h; preperfusion lasted for 20 before the onset of sampling from the inferior vena cava Liver samples were taken from the front lobe at 35 Lipid extraction...
- 12
- 592
- 0
Tài liệu Báo cáo khoa học: "k-valued Non-Associative Lambek Categorial Grammars are not Learnable from Strings" pptx
Ngày tải lên :
20/02/2014, 16:20
... in grammars to be not greater than This holds for all variants of Lambek grammars as a corollary of the equivalence between generation in classical categorial grammars and in Lambek systems for ... formula A Let Σ be a fixed alphabet A categorial grammar over Σ is a finite relation G between Σ and T p If < c, A >∈ G, we say that G assigns A to c, and we write G : c → A 2.1.1 Lambek Derivation ... greater than order are not learnable from strings - k-valued free pregroup grammars with types not greater than order are not learnable from strings5 The learnability question may still be raised...
- 8
- 345
- 0
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc
Ngày tải lên :
22/02/2014, 04:20
... (steric) interactions also need to be considered Comparison of Cu(II) and Ni(II) binding between model peptides and albumins Afnity for Ni(II) at site I can be compared between albumins on one hand ... at site I of HSA Because of the slowness of Ni(II) binding at site I (see below), but not at site II, the equilibration of reaction at each point of Ni(II) titrations had to be assured by recording ... the Cu(II) ion in the DAHKam complex, compared to DAHam may be due to a tiny deviation from tetragonal symmetry caused by an interaction between the protonated Lys side chain and the His ring,...
- 9
- 627
- 0
Tài liệu Báo cáo Y học: Transactivation domains are not functionally conserved between vertebrate and invertebrate serum response factors potx
Ngày tải lên :
22/02/2014, 07:20
... promoter have been described [43] This later mechanism could be responsible for the activation of the CA promoter The repressor effect of DmSRF and, to a lesser extend, AfSRF could be explained ... that had been shown to be sufficient for SRF-dependent regulation, were used in these studies The CA promoter contained the two more proximal CArG boxes that have been identified [9] Besides, we ... domains have been very conserved during evolution MADS-box regions are 98% identical and SAM-domains over 79% identical between vertebrate and invertebrate SRFs No similarity has been detected...
- 9
- 392
- 0
Báo cáo khoa học: Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast potx
Ngày tải lên :
07/03/2014, 05:20
... could be replaced with serine as well as with cystein and methionine Cells expressing mutants T56C and T56S grew markedly slower than cells expressing tagged wild-type eEF2 while mutant T56M had less ... mutants T58S and T58V grew slower than control cells expressing the tagged wildtype eEF2 and showed a slight decrease in the number of viable cells Thus, T58 could be replaced by valine whereas the ... the type II Ca2+ and calmodulindependent kinases [36] It has been speculated that the general role of eEF2 phosphorylation may not be a massive shut-down of protein synthesis but rather a mechanism...
- 13
- 424
- 0
Báo cáo khoa học: Mutagenesis of hydrogenase accessory genes of Synechocystis sp. PCC 6803 Additional homologues of hypA and hypB are not active in hydrogenase maturation ppt
Ngày tải lên :
08/03/2014, 08:20
... nitrilotriacetate could not be abolished in DhupE However, by adding 200 and 300 lm, growth could be continuously increased Above 300 lm Ni2+ no further increase could be elicited, probably because of toxic ... acknowledged Special thanks to T Eitinger (Humboldt-University, Berlin) for helpful discussions We thank Sabine Karg and Monika Schneeweiss for excellent technical assistance References Volbeda A, Charon ... the best candidate for a hydrogenase-specific protease with a similarity of 54 and 43%, respectively Because deletion of slr1876 resulted in a mutant without hydrogenase activity, Slr1876 can be...
- 12
- 415
- 0
Báo cáo khoa học: "Rigid Grammars in the Associative-Commutative Lambek Calculus are not Learnable" pptx
Ngày tải lên :
08/03/2014, 21:20
... of a" +a" (a" and "' may be empty) - Grammar G + assigns TDFp as range subtypes to c, so Tree + can simply be c H c/c Some reflection will show that other possibilities must be of the (normal) ... exists another language L in f such Note that, unless otherwise stated, the empty sequent is not allowed, i.e I— A may not occur in any derivation Lambek variants which allow the empty string have ... in G,), therefore c H aVaa) must be in Tree, All the other types found in this tree must be introduced by hypotheses, and all the hypotheses introduced have to be eliminated within Tree„, and...
- 8
- 454
- 0
You Are Not a Gadget: A Manifesto (Vintage)
Ngày tải lên :
15/03/2014, 15:20
... soon, maybe twenty or thirty years into the twenty-first century, computers and robots will be able to construct copies of themselves, and these copies will be a little better than the originals because ... files may be more persistent than our ideas about nature I can imagine that someday physicists might tell us that it is time to stop believing in photons, because they have discovered a better ... could play better than the very best human There was much talk about whether human beings were still special, whether computers were becoming our equal By now, this sort of thing wouldn‟t be news,...
- 129
- 401
- 0
The People of Forever Are Not Afraid by Shani Boianjiu doc
Ngày tải lên :
22/03/2014, 09:20
... on the field bed across from mine I wanted to reach over and grab her hand, so that she would be less cold, so that I would be less alone I couldn’t Because of the needle in my arm, because it ... females, we can’t tell what will become of us next based on what questions we raise our hands for I know the least because I was the first of the girls in my class to be drafted, so I didn’t have ... humiliating all at once I am sort of impressed I wish I were a better soldier At night, I think about everything except how to become a better soldier, no matter how hard I try Dan, Mom, Yael People...
- 17
- 362
- 0
Báo cáo khoa học: "NATURAL LANGUAGE TEXTS ARE NOT NECESSARILY GRAMMATICAL OR EVEN COMPLETE" pot
Ngày tải lên :
24/03/2014, 01:21
... they are quite often correct, always better than a "CANNOT PARSE" outcome, and appear to be fairly usable for style critiquing In the future we believe more can be done with sentence fragments by ... user-oriented function than an internal robust recovery procedure Nonetheless, from the point of view of the style critiques at the sentence and paragraph levels, this procedure assures the best possible ... metric which computes a real number for each parse, based on its structural features, with the decision rule simply being to choose the parse with the smallest number (~) Our experience with this...
- 2
- 222
- 0
The Games Are Not the Same The Political Economy of Football in Australia pot
Ngày tải lên :
24/03/2014, 02:21
... will be framed by a model of sport-as -business that sees sport in general going through a number of developmental phases over the last fifty years This metamorphosis into sport-as -business begins ... The marketing process also becomes increasingly more sophisticated as the sport club, association or league becomes a brand, members and fans become customers, sponsors become corporate partners, ... quoted in this book Any person or organisation that may have been overlooked or misattributed may contact the publisher Designed by Phil Campbell Typeset by J&M Typesetting Printed in Australia...
- 367
- 426
- 0
state university of new york press the perils and promise of global transparency why the information revolution may not lead to security democracy or peace oct 2006
Ngày tải lên :
11/06/2014, 12:45
... tangible security benefits, but the more important outcome may be agreeing on what behaviors are destabilizing and then visibly avoiding such behavior Evidence that states share norms of behavior can ... military strength may actually make states less secure Even though a state may arm only to defend itself and its interests, other states cannot be certain of this motivation To be on the safe side, ... Just as paper may be blank or printed and may be used to transmit all sorts of messages, information technologies are not themselves information providers These five factors can be mutually reinforcing,...
- 210
- 433
- 0
báo cáo hóa học:" Human immunodeficiency virus and human papilloma virus - why HPV-induced lesions do not spontaneously resolve and why therapeutic vaccination can be successful" pot
Ngày tải lên :
18/06/2014, 15:20
... HAART are lacking but it would be safe to assume that the response rate and type of HPV-specific immune response in HIV-positive patients on HAART at least is not better than that of immunocompetent ... patients with AIN1-AIN3 with imiquimod may result in good clinical responses in patients with good compliance [78-80], albeit that these results have to be confirmed by others Notably, despite ... immunity in HAART-treated patients HPV-specific therapeutic vaccination to treat may now become an option The clear link between HPV16 and cancers of the cervix, vulva and anal region has prompted...
- 8
- 634
- 0
Báo cáo hóa học: " Mutation or loss of Wilms’ tumor gene 1 (WT1) are not major reasons for immune escape in patients with AML receiving WT1 peptide vaccination" ppt
Ngày tải lên :
18/06/2014, 16:20
... marrow samples Bone marrow and peripheral blood samples have been collected before vaccination and during progression in heparinized tubes and mononuclear cells (MNCs) were isolated by Ficoll Isopaque ... complementary detection probe pairs were used (P, dephosphorylated; X, Fluorescein; Y, LC Red 640): probe pair 1: 5’-Y GCGCGTTAGGAAACATCCTGG P, 5’TGGCCGGATGACGCCTGG X, probe pair 2: 5’-Y CTGGGCAGGTAGGGC ... Acknowledgements We thank David Stather for technical help Author details Charité - CBF, Department of Medicine III, Berlin, Germany 2Institute of Medical Immunology, Charité - CCM, Berlin, Germany...
- 4
- 424
- 0
Báo cáo hóa học: " Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity" ppt
Ngày tải lên :
18/06/2014, 16:20
... with the concept that it may be possible to generate an effective immune response without a robust inflammatory response [47] and such properties may even make IRAK4 an attractive drug target for ... molecules such as PI3K, Btk, Tlp-2, and NIK and activate MAPKs and NFB Regardless, it can be concluded that pathways other than the classic MyD88-dependent pathway (via sequential activation of IRAK4, ... magnetic beads (M450; Dynal; Invitrogen) as described [27,28] RNA was isolated from monocytes with RNeasy Mini kit and analyzed using an Agilent 2100 Bioanalyzer (Agilent Technologies) as described...
- 12
- 698
- 0
68PART ONE A Trader’s Journeypsychology. They realize that traders are not experts in every ppt
Ngày tải lên :
22/06/2014, 18:20
... Trading becomes effortless, easy, fun Everything becomes clear and simple The way to this simplicity takes you through many complications, but when they are behind you, they become nothing more than ... The number of familiar situations grows The fewer the number of situations that look totally new and unfamiliar to us, the more confident we feel The market ceases to be a great mystery It becomes ... such simplicity, it is difficult to remember and describe all the hassles A very brief explanation wouldn’t be too helpful to newer traders, since they need to be informed about the process of learning...
- 27
- 206
- 0