enemy apos s enemy is a friend
Why is a dog offten called “man’s best friend” (hùng biện Tiếng Anh)
Ngày tải lên: 07/10/2017, 08:27
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... pSTB10 DNA sequence analysis An automatic plasmid isolation system PI-100 (Kurabo, Osaka, Japan) was used to prepare the double-stranded DNAs for sequencing The plasmid pSTB10 was used as a sequencing ... 5¢-CGATCCAAGCTTTAAGGAGG AAtagGAAATGGAATTCATCGAAAAAATCCG-3¢ antisense primer, 5¢-TGCATCCATCTAGAGCATTCA GC-3¢ The amplified PCR product was digested with HindIII and XbaI, separated by agarose gel electrophoresis, and ... reported, LaaA from P azotoformans IAM 1603 is the first L-amino acid amidase whose primary sequence is revealed Acknowledgements We are grateful to S Iwamoto, R Kasahara and A Nakayama (Toyama Prefectural...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG S: ... GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S: GCCTCTTTAGAAGATCAAAAGTAGG ... External S: GAGACTGGATAGGCTTGTAG External F: GCGCCGAGGACCCCG Internal S: ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot
... the seven isoforms (b, f, s, r, e, g and c) using a BiometraTM slot blot apparatus A summary of these antisera is shown in Table and [41] (A) Whole HeLa cell lysate HeLa cell lysates were subjected ... translocated into the eukaryotic cells by a genetically defined Y pseudotuberculosis strain and also by several different Pseudomonas aeruginosa strains [34,35] The Yersinia strain expresses and translocates ... ExoS and 14-3-3 in vivo We have shown earlier that Ras (and its deactivation of downstream targets such as Erk and PKB/Akt), and many other small GTPases are modified by ExoS, expressed and translocated...
Ngày tải lên: 31/03/2014, 08:20
báo cáo hóa học: " Vascular consequences of passive Aβ immunization for Alzheimer''''s disease. Is avoidance of "malactivation" of microglia enough?" docx
... by A was at least partially responsible for AD-associated degeneration, others had pointed to microglial phagocytosis as a desirable consequence of activation For the purposes of discussion, ... Paris D, Humphrey J, Quadros A, Patel N, Crescentini R, Crawford F, Mullan M: Vasoactive effects of A beta in isolated human cerebrovessels and in a transgenic mouse model of Alzheimer 's disease: ... triggered by anti -A antibodies Furthermore, the investigators also found that the CAA was accompanied by an increase in hemorrhages – similar to a previous report [19] – and a vascular accumulation...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa" pdf
... univariate analysis, but not on multivariate analysis This is likely because the effects of advanced KS disease (T1 and S1 stages) were much stronger than CD4 count Advanced T and S stage were strongly ... months Disseminated Cutaneous Lesions IRIS Table Associations with mortality in AIDS-KS patients Mortality 112 (59) Unadjusted 34(29-41) 82 (31-174) HR Site of Kaposi s sarcoma Lesions Oral 122 ... http://www.jiasociety.org/content/13/1/23 Page of Table Demographic and disease characteristics of AIDSKS patients Males Age at time of AIDS-KS diagnosis, years Median baseline CD4+ count, cells/mm3...
Ngày tải lên: 20/06/2014, 08:20
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx
... (LAUGH) store still has to buy ads in the paper BECKY: Right, there are— are two proposals in congress that have gotten a lotta play One is from senate— is from Congressman Barney Frank who takes ... particular March, April, and May, it 's it 's it 's shown some acceleration So what 's happening in Europe has not had an effect here yet in— in terms of our businesses It 's it 's a dangerous situation, ... after state has regulations relating to insurance companies that ties in with the rating agencies And the agencies are specified And so I can't go to the XYZ rating agency and say, "Will you this...
Ngày tải lên: 28/06/2014, 17:20
Let''''s face it -- English is a crazy language pps
... priceless ones? If appropriate and inappropriate remarks and passable and impassable mountain trails are opposites, why are flammable and inflammable materials, heritable and inheritable property, and ... the same English? How can it be easier to assent than to dissent but harder to ascend than to descend? Why is it that a man with hair on his head has more hair than a man with hairs on his head; ... does a freedom fighter fight? If a horsehair mat is made from the hair of horses, from what is a mohair coat made? A slim chance and a fat chance are the same, as are a caregiver and a caretaker,...
Ngày tải lên: 12/07/2014, 15:20
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido ... with a β-galactosidase expressing plasmid, and either a 17-5p 2'-O-Me ASO or a scrambled sequence ASO Luciferase signals were normalized to β-galactosidase signals (as a control for transfection ... WC, and NC cloned miRNA target sites AS and NC generated stable cell lines, and performed luciferase and β-galactosidase assays AS, SW, and NC performed western blots All authors read and approved...
Ngày tải lên: 14/08/2014, 20:22
Wicked problems a value chain approach from Vietnam's dairy product
... This author s main research areas are International Economics, Global Value Chain and E-Commerce His latest researches have addressed some key issues in MNCs and Trade, Supply Chains under Globalization ... region (such as in Thailand 23 liters/capita/year or China 25 liters/capita/year) Nevertheless, this ratio has been considerably increased as compared to the ones of last years Currently, the segment ... one another, especially between dairymen and processing plants This causes some negative effects on the actors as well as the sustainable development of dairy sector Measures According to the aforementioned...
Ngày tải lên: 15/12/2017, 01:51
A Study on Factors Influencing user's Continuance Intention of Mobile SNS
... mobile SNS has significant effect on user satisfaction missing value some of the returned questionnaires, 250 H2-3: is usable for further analysis Context-based supply of mobile SNS has significant ... this study Accuracy of mobile SNS has significant effect on perceived usefulness Results and discussions H4-2: Hypothesis Testing Accuracy of mobile SNS has significant effect on user satisfaction ... related studies on the empirical analysis between e of SNS create attention the factors of Mobile SNS users’ satisfaction and continuance usage is still lacking Therefore, this study will focus on...
Ngày tải lên: 15/12/2017, 07:22
What is a Company Visual Identity?
... Amsterdam Abbreviations Abbreviations are to be avoided as much as possible in both internal and external correspondence The usual abbreviations in English are: Mr., Mrs., Messrs., Miss or Ms ... form? - Does a form with a similar function already exist, or can this new form be combined with an existing form? - Does the form have a name, and is this name as short as possible? - Is all the ... concerns all magazines, folders and brochures issued by the Heineken organisation If these starting-points are applied consistently, a recognisable and uniform image can be guaranteed while allowing...
Ngày tải lên: 23/10/2012, 13:53
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis ... values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation purposes) ... variables were found to be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... diagnosis of sepsis on ICU admission Moreover, the effectiveness of this sepsis marker in our study was assessed in the differential diagnosis between all sepsis-related conditions and SIRS The ... baseline) Septic shock is a subset of severe sepsis and is defined as a persisting sepsis-induced hypotension despite adequate fluid resuscitation Infection was diagnosed by textbook standard criteria ... the diagnosis of sepsis on ICU admission The diagnosis of sepsis is difficult, particularly in the ICU where signs of sepsis may be present in absence of a real infection [25] The effort of many...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... level in all analyses Statistical analysis Results Statistical analyses were performed using SigmaStat (version 3.0, SPSS Inc., Chicago, IL) Independently measured t-tests were used to compare endpoints ... values less than 0.05 were considered statistically significant Presented data are shown as mean ± SEM, unless otherwise CSF Levels of Vgf correctly diagnose ALS and associates with clinical severity ... Decreased Vgf content In CSF and serum precedes onset of ALS-type muscle weakness assessed by rotarod-assays In our laboratory setting, G9 3A mutant SOD-1ALS mice develop muscle weakness by ~90 days...
Ngày tải lên: 03/11/2012, 10:52
Life Is a Dream
... philosophical significance LIFE IS A DREAM DRAMATIS PERSONAE Basilio King of Poland Segismund his Son Astolfo his Nephew Estrella his Niece Clotaldo a General in Basilio 's Service Rosaura a Muscovite Lady ... national type of drama which Lope had established was maintained in its essential characteristics by Calderon, and he produced abundant specimens of all its varieties Of regular plays he has left a ... Vega, the most prolific and, with Calderon, the greatest, of Spanish dramatists, was still alive; and by his applause gave encouragement to the beginner whose fame was to rival his own The national...
Ngày tải lên: 06/11/2012, 14:12
Effect of sensory education on school children’s food perception: A 2-yearfollow-up study
... exercises The contents of the lessons are described in Appendix In both education waves, the practical exercises and activation of senses played a major role 2.6 Data analysis The ratings of ... Limpan Ltd.) and grainy wheat toast (Jyväinen IsoPaahto, Vaasan and Vaasan Oy); in the third followup two premium breads, garlicky cheese ciabatta (Artesaani, Primula Oy) and grainy rye bread (Artesaani, ... the last follow-up session, as that session had a limited space and time frame that required adjustments Taste identification Taste compound Sucrose (sweet) NaCl (salty)2 Citric acid (sour)2 Caffeine...
Ngày tải lên: 03/04/2013, 21:07