em stevens johnson syndrome sjs and toxic epidermal necrolysis ten

... links between 1) EM, SJS, TEN and phenytoin and radiation therapy of all body systems except cranium and 2) EM, SJS, TEN and levetiracetam with radiation therapy of all body systems including cranium ... SJS: Stevens- Johnson Syndrome; EMPACT: Erythema Multiforme associated with Phenytoin And Cranial Radiation Therapy; EM: Erythema Multiforme; TEN: Toxic Epidermal Necrolysis Competing interests ... treatments of brain and spine The weaning of dexamethasone may contribute to the development of SJS as well EM- SJS- TEN syndrome is well described in patients receiving concurrent phenytoin and cranial...

Ngày tải lên: 09/08/2014, 09:20

... Bihari DJ, Simmons NA: Cephalexin induced toxic epidermal necrolysis J Antimicrob Chemother 1999, 28(3):477-478 Hogan DJ, Rooney ME: Toxic epidermal necrolysis due to cephalexin J Am Acad Dermatol ... authors read and approved the final manuscript References Chave TA, Mortimer NJ, Sladden MJ, Hall AP, Hutchinson PE: Toxic epidermal necrolysis: current evidence, practical management and future ... trimethoprim-sulfamethoxazole, trimethoprim, and cephalexin for uncommon serious drug toxicity Pharmacotherapy 1995, 15(4):428-432 Okana M, Kitano O, Ohzono K: Toxic epidermal necrolysis due to cephem Int J Dermatol 1988,...

Ngày tải lên: 11/08/2014, 14:21

... hospitalization and decreasing the mortality rate significantly Keywords: Steven Johnson syndrome ĐẶT VẤN ĐỀ Hội chứng Stevens- Johnson (SJS) dạng bệnh hồng ban đa dạng (Erythema multiforme – EM) gây ... allergic to foods; cases (2.85%) due to chemical products; case is bitten by ant and 13 cases (18.57%) suspected to be infected with viruses and microbes Erythema multiforme was noted in almost all ... Steven Johnson ABSTRACT Objectives: To review the characteristics in epidemiology, clinical manifestations, laboratory findings as well as the actual treatment in children with Steven Johnson syndromes...

Ngày tải lên: 01/08/2014, 05:20

... bound to CeMT-1 and CeMT-2 if presented with Zn : Cd ratios as encountered by C elegans Using a Cd : Zn ratio of 33 : [21 nm Cd(II) and 0.7 lm Zn(II)] and 0.1 lm of CeMT-1 and CeMT-2 each, and the ... species, and the data compiled for Zn6-CeMT-2, Cd6-CeMT-2 and Zn7-CeMT-1 in Fig and Table show that this was achieved by expression in the presence of the desired metal ion However, the CeMT-1 form ... 98.6% of Cd(II) is bound to CeMT-2, and only 1.4% to CeMT-1 Zn(II) is more evenly distributed (45 : 55%) between CeMT-1 and CeMT-2 When equimolar amounts of Zn(II) and Cd(II) are used (0.65 lm...

Ngày tải lên: 16/02/2014, 15:20

... nhiên gây biến chứng mù lòa Chẩn đoán phân biệt - Viêm da Herpes - Viêm da tiếp xúc bọng nước - Pemphygus - Hội chứng Lyell Điều trị Điều trị theo nguyên nhân: Do herpes: dùng acyclovir 200 mg...

Ngày tải lên: 02/07/2014, 23:20

... cộng thấy từ 1972-1986 tỷ lệ TEN 0,5/1 triệu người/năm; Strom cộng nghiên cứu Michigan, Minnesota, and Florida thấy tỷ lệ SJS 7,1; 2,6 6,8 triệu người năm Tỷ lệ TEN Thuỵ Điển 0,4/1 triệu người/năm, ... tuổi, trung bình 46,8, 14% bệnh nhân

Ngày tải lên: 07/07/2014, 15:20

Ngày tải lên: 07/07/2014, 15:20

... nhiên gây biến chứng mù lòa Chẩn đoán phân biệt - Viêm da Herpes - Viêm da tiếp xúc bọng nước - Pemphygus - Hội chứng Lyell Điều trị Điều trị theo nguyên nhân: Do herpes: dùng acyclovir 200 mg...

Ngày tải lên: 21/07/2014, 18:20

... cộng thấy từ 1972-1986 tỷ lệ TEN 0,5/1 triệu người/năm; Strom cộng nghiên cứu Michigan, Minnesota, and Florida thấy tỷ lệ SJS 7,1; 2,6 6,8 triệu người năm Tỷ lệ TEN Thuỵ Điển 0,4/1 triệu người/năm, ... tuổi, trung bình 46,8, 14% bệnh nhân

Ngày tải lên: 22/07/2014, 11:20

... nhiên gây biến chứng mù lòa Chẩn đoán phân biệt - Viêm da Herpes - Viêm da tiếp xúc bọng nước - Pemphygus - Hội chứng Lyell Điều trị Điều trị theo nguyên nhân: Do herpes: dùng acyclovir 200 mg...

Ngày tải lên: 28/07/2014, 13:20

... + SJS biểu tổn thương hồng ban đa dạng rộng da niêm mạc, hay bùng phát đột ngột, lan thành đám, túi ... >160/90; 10< Thở >25; Thân nhiệt >38.5; SpO2 < 90% Điều trị đặc hiệu Chưa có thuốc đặc hiệu với SJS Có thể cho: + Globulin miễn dịch 1g/kg/ngày khoảng ngày + Cyclosporine 2, 5-5mg/kg uống chia ... khả giảm đau & cải thiện nhanh tổn thương da - Người lớn 600-800mg x lan/ngày x 7-10 ngày - Trẻ em dùng liều 10mg/kg hay 500mg/m2 IV/8 5.Điều trị triệu chứng +Điều trị HS phải bồi phụ nước điện...

Ngày tải lên: 29/07/2014, 03:20

... A (SpeA) and other secreted superantigen toxins are potential candidates for vaccines because these proteins are associated with many outbreaks of streptococcal toxic shock syndrome and are virulence ... Based Therapies and Vaccines 2008, 6:8 5' GAATTCGGATCCGCTAGCCTACAACAG 3' For cloning, the SpeA (L42R) gene was used as a PCR template and primers and were used to prepare a doublestranded sequence ... CWS Emulsion, RIBI ImmunoChem Research, Inc., Hamilton, MT) This research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and...

Ngày tải lên: 11/08/2014, 10:23

... an unstable pelvic fracture Measurements Systolic and diastolic arterial pressures (SAP and DAP), and systolic and diastolic pulmonary arterial pressures (SPAP and DPAP) were simultaneously measured ... oxygen (PvO2) and PaCO2 were measured using an IL BGETM blood gas analyser Hemoglobin concentration, methemoglobin concentration, and arterial and mixed venous oxygen saturations (SaO2 and SvO2) ... Opticath Catheter, Abbot Critical Care System) and a radial or femoral arterial catheter In order to accurately assess the extension of pulmonar hyperdensities, and thereby the severity of ARDS patients...

Ngày tải lên: 12/08/2014, 18:20

... NCI-H441, and human fetal lung explants H441 cells resemble bronchiolar epithelial Clara cells in phenotype and produce both SP-A and SP-B mRNA and protein [14] The hormonal regulation of SP-A and ... LY294002, rapamycin and PD98059 were reconstituted in dimethyl sulphoxide as mM, 50 mM, 50 µM and 10 mM stock solutions, respectively, and stored at -80°C in aliquots Insulin causes a timeand dose-dependent ... vehicle or insulin (2.5 µg/ml) for an additional 1, 4, and 24 hours The cells were then rinsed and trypsinized, and nuclei from control and treated cells were harvested The transcription elongation...

Ngày tải lên: 12/08/2014, 18:20

... sICAM-1, and sVCAM-1, and RIA kits for IL-1) and were used according to manufacturer's instructions All the measurements were done within months of the sample collection Intra-assay and interassay ... cytokines and adhesive molecules were not significantly different Measurement of the plasma cytokines and soluble adhesion molecules The assay method for cytokine measurement was the same for blood and ... and VCAM-1 expression is induced mainly by IL1b and TNF-α However, the levels of TNF-α and IL-1 were not predictive for the development of the syndrome BALF soluble adhesion molecules sICAM and...

Ngày tải lên: 12/08/2014, 18:20

... infarction, and pulmonary embolism, four with neurological diseases and stroke, and two with poisoning), 49 trauma patients (37 with multiple trauma and 12 with head injury only) and 71 sepsis/SS ... ml) and noninfected patients (PCT = 0.27 + 0.02 × SOFA score, ng/ ml) * P < 0.02 ᮀ and solid line, infected and regression line; + and dashed line, noninfected and regression line Figure mg/l) and ... dysfunction, and in the various severities of a systemic inflammatory response syndrome (SIRS) Also, differences in body temperature (BT), heart rate, white blood cell (WBC) count, and respiratory...

Ngày tải lên: 12/08/2014, 20:20

... Pressure Management Blood Pressure Management In Children and Adolescents In Children and Adolescents Non-Pharmacologic Therapies Weight management Physical activity Hypertension Hypertension Sodium ... PROBLEM - Obesity (and insulin resistance) in children – a worldwide epidemic - Great risk of Metabolic Syndrome and/ or Type Diabetes at an earlier age - Great risk of medical morbidity and disability ... Angiotensin Receptor Blocker (Losartan Thiazide Thiazide Diuretics Diuretics (HCTZ) (HCTZ) β- Blocker β- Blocker (Atenolol) (Atenolol) Avoid if severe Avoid if severe hypoglycemia hypoglycemia...

Ngày tải lên: 12/08/2014, 20:58

... adequate relief of abdominal pain and discomfort, and improvement in bowel frequency, consistency, and urgency of bowel movement,379 400 with NNT = 7.406 Again extended use studies suggest that ... Lilley and Company Dr Emmanuel has been reimbursed for travelling and conferences by GSK and Novartis and has received research funding from GSK Dr Houghton has received remuneration for advice and ... benefits some patients It is also worth remembering that IBS patients often show fat intolerance and it has been shown that lipid can induce greater gas retention256 and increase visceral hypersensitivity314...

Ngày tải lên: 13/08/2014, 09:44

... citation purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2009, 17:10 http://www.sjtrem.com/content/17/1/10 and CVP tend to be erroneously elevated and no longer reflective ... purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2009, 17:10 http://www.sjtrem.com/content/17/1/10 Appendix – Signs of Abdominal Compartment Syndrome 14 Abdominal distention ... hypertension and abdominal compartment syndrome in 2007 Acta Clin Belg Suppl 2007, 1:66-73 Madigan MC, Kemp CD, Johnson JC, Cotton BA: Secondary abdominal compartment syndrome after severe extremity...

Ngày tải lên: 13/08/2014, 23:20

... Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2009, 17:17 http://www.sjtrem.com/content/17/1/17 Timing of decompression Clinical experience seems to indicate ... purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2009, 17:17 http://www.sjtrem.com/content/17/1/17 SLAF is effective in about 50–70%, prevents open abdomen and its related ... associated with the management and complications of the open abdomen Management of the open abdomen In view of the complicated and often fatal outcome of patients ending up with a persistent open abdomen...

Ngày tải lên: 13/08/2014, 23:20