em based precise lcdg approximation of a probability distribution

... their paper, sometimes a shape of constant diameter like a Reuleaux triangle (see Figure 2.1) rather than a circle is formed In a Reuleaux triangle, arcs ab, bc and ca are drawn with radii equal ... behaviour -based system with other navigational behaviours so that a robotic team can reach navigational goal, avoid hazards and simultaneously maintain in their intended formation The other common architecture ... behaviour and launch obstacle-avoidance behaviour 3.4 Encirclement Strategy The switching between target-tracking behaviour and target-circumnavigation behaviour plays a very important role to attain...

Ngày tải lên: 15/09/2015, 22:43

... Prototype of Krupp Fast Handling System (From [9]) Krupp, a German manufacturer of marine cranes and mining material handling, has developed an automated system design specifically for intermodal rail ... models are available, they should be used, and that simulation should be resorted for cases where either analytical models are not available and approximations are not acceptable or they are so ... expensive and scarce land resources at terminal sites, wastage of capital in inventory, longer waiting time of trucks and ships, and a larger fleet size of yard-trucks Implementing AS/RS in a container...

Ngày tải lên: 26/11/2015, 12:46

... use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... evaluation of Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents ... Chelates as MRI Contrast Agents: Structure, Dynamics and Applications CHEM REV 1999; 99: 2293-352 Ersoy H, Rybicki FJ Biochemical safety profiles of gadolinium -based extracellular contrast agents...

Ngày tải lên: 26/10/2012, 09:07

... to the actual characteristics of the robot This means that the rough and manual tuning of the parameters of the fuzzy controller is replaced by a fine local automatic tuning and Table Angular speed ... elementary behavior of wall-following type including the creation of transition sub-goals develop a second strategy S2 As a matter of fact, the idea is to anticipate in order to avoid a potential ... evolved automatically with the sensor data (Fig 5) The shape of the membership function is triangular and the sum of the membership degrees for each variable is always equal to The universes of discourse...

Ngày tải lên: 23/10/2013, 15:15

... system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are ... are all above 5800 mAh, the system is reliable because the required capacity is reached But when we analyze the system reliability using the traditional system reliability theory, the system fails ... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi-state system theory According to (2), the universal generating function of the battery...

Ngày tải lên: 03/01/2014, 19:38

... CIT and/or SIT positively correlates with front line employee quality training and pervasiveness of the quality management system An important advantage of CIT and SIT is the usability of the data ... activity that is based on standardized questionnaires that are delivered to a sample of the customer base These quantitative multi-attribute questionnaires are then analyzed via statistical techniques ... satisfaction scales and the proliferation and excessive use of surveys (Altany, 1993; Mehta, 1990) Additional problems mentioned are haphazard sampling (11/37) procedures, the quality of survey data and...

Ngày tải lên: 15/01/2014, 15:59

... calibrated against a master examiner The kappa statistic was used to assess the inter-examiner reliability of caries and the final kappa scores were higher than 0.8518 Data on oral health behaviour of ... et al.: School -based oral health education programme in Wuhan City 36 Data analysis All data sheets were transferred to the University of Copenhagen and analysed by means of the SPSS system ... independentsamples t-test for mean scores as regards the clinical variables while the Chi-square test was applied for categorial variables Results Oral health status and behaviour of children At baseline...

Ngày tải lên: 14/02/2014, 13:20

... others Semantic analysis of a sample of natural text stock reports discloses that a hierarchy of approximately forty message classes accounts for nearly all of the semantic information contained ... in a knowledge -based report generator, occur at one of the higher cognitive gtrata (p _ l.setparams (goal "stat act "op setparams) (remove 1) (make paramsyllables "val 30) (make parammessages ... sublanguage, but it also reveals the essential semantic classes and attributes of a domain of discourse, as well as the relations between those classes and attributes Thus, samples of actual text...

Ngày tải lên: 21/02/2014, 20:20

... for evaluation on bare labels suggests that our approach is capable not only of adding functional tags, but can also correct the parser’s phrase labels and partof-speech tags: for Collins’ parser ... parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and the Penn Treebank allowed us to recover functional tags (grammatical and semantic), ... of a pattern and the features of all the nodes involved We trained a separate classifier for each pattern For evaluation purposes we extracted all occurrences of the patterns and the features of...

Ngày tải lên: 08/03/2014, 04:22

... motivation, and denotational-semantic adequacy The basic idea is that latent classes are computational models of the atomic relation symbols occurring in lexical-semantic representations As a first ... algorithm h a v e foundations in the theory of parameterized families of probability distributions and statistical estimation As exemplified in the paper, learning, disambiguation, and evaluation ... with a head-lexicalized PCFG In Proceedings of EMNLP-3, Granada Ido Dagan, Lillian Lee, and Fernando Pereira to appear Similarity -based models of word cooccurence probabilities Machine Learning A...

Ngày tải lên: 08/03/2014, 06:20

... Strickland and Joan Woods, USAID, Washington, DC, USA V Chandra-Mouli, Child and Adolescent Health, WHO/HQ, Geneva, Switzerland Charles Gollmar, CDC, Atlanta, GA, USA Delia Barcelona, UNFPA/Headquarters, ... and local prevalence rates; and available methods of contraception - analyse a variety of potential situations for sexual interaction and determine a variety of actions they may take and the ... of health knowledge, health-related skills, and positive attitudes toward health and well-being Typically, health education targets a broad range of content areas, such as emotional and mental...

Ngày tải lên: 14/03/2014, 20:20

... propose a variation of the UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part of the algorithm is the sampling step An episode of this ... because a statistical paraphrase table, an analogical solver and a paraphrase memory for instance; there is no constraint on the scoring function because it only scores final states Note that ... principle of the two-step evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator...

Ngày tải lên: 17/03/2014, 02:20

... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA ... 667–674 239 CAGCTgtaag/tccagGTCTG A B C D 163 243 671 261 CAGCTgtaag/tccagGTCTG GGGCGgtgag/tccagTTGAA AGGCGgtgag/caaagCTGAA GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT...

Ngày tải lên: 17/03/2014, 03:20

... local approach has a number of advantages over computing a global analysis First, as just noted it is much more efficient to compute these partial analyses rather than to compute global analyses of ... initial analysis, replacing the bigram language model with a syntactic parser based model We not need to intersect this parser based language model with our TAG channel model since we evaluate each ... P(X) of the source string using the syntactic parser based language model, is our best estimate of the probability of an analysis However, there is one additional complication that makes a marked...

Ngày tải lên: 17/03/2014, 06:20

... paragraph as important, and the other sentences as not important We included this approach merely as a simple baseline 2.2 Word -based approaches Word -based approaches to summarization are based ... sentence rankings than the paragraph -based approach provides NoParagraph mean rank correlation coefficient WithParagraph 0.6 0.5 0.4 0.3 0.2 0.1 MSWord Luhn tf.idf MarcuAvg MarcuMin MarcuMax in-degree ... commercially available summarizer, the MSWord summarizer, against human sentence rankings Our reason for including an evaluation of the MSWord summarizer was to have a more useful baseline for scalable...

Ngày tải lên: 17/03/2014, 06:20

... WO3 that is characteristic of diffuse electron diffraction rings demonstrate that the walls of our material are made up of nanocrystallite This is also supported by the dark field TEM image (Fig ... 225 at National Cheng Kung University, Tainan, Taiwan His major research has related to mesoporous materials, and battery materials Jiann Shieh received his BS, MS and PhD degrees of Materials Science ... Tainan, Taiwan, 2001 His major research has related to mesoporous materials, semiconductor gas sensor, and nanomaterials Min Hsiung Hon is a professor in the Department of Materials Science and Engineering...

Ngày tải lên: 20/03/2014, 13:07

... experienced while navigating through the site A suggested enhancement to the navigational capability of the site was a text -based replication of site navigation bar at the top of each page to make scrolling ... Area’ For each activity, a single graphic was selected and placed at the top left corner of each page of that activity as a visual cue for students engaged in a particular learning activity The ... activities and tasks in more detail resulted in a clarification of the structure of each learning activity and thus, a proliferation of pages for each activity Now, each learning activity is associated...

Ngày tải lên: 28/03/2014, 21:20

... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced ... proteins [26–32] Many of the post-translational modification pathways, such as phosphorylation, glycosylation, myristoylation and palmitoylation present in mammalian systems are also utilized in...

Ngày tải lên: 30/03/2014, 20:20

... concept- The Transaction demand- The Asset demand for money: Keynesian and Classical approaches- Wealth approach- Post-Keynesian theories of demand for money: Friedman's Restatement of Quantity theory, ... new classical approach - empirical evidence Approach of Mundell and other economists on open economy Asset Markets, Theory of Rational expectations - Monetary approach of balance of payment Basic ... factors, economic status, health, education, nutrition, caste, religion, race, rural-urban and status of husband and wife; Nuptiality Concept and analysis of marital status, single mean age at...

Ngày tải lên: 31/03/2014, 03:20