efficiency kinetics protocol using synthetic csps
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx
... prevalence of STEC in cattle, pigs, and chickens using different detection methods and to define the molecular characteristics of the isolates using multiplex PCR and RAPD The conventional culture ... an automated IMS in combination with an integrated ELISA (EiaFoss; Foss, Denmark) would increase efficiency and lighten the workload This method can test about 81-108 samples per day, after overnight ... (iii) to compare the genetic patterns of Korean isolates and U.S isolates, and (iv) to compare the efficiency among conventional culture method, IMS, and E coli O157:H7 commercial diagnostic kit,...
- 13
- 456
- 0
Báo cáo khoa học: " Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007" docx
... M A M J J A S O N D J F M Figure distribution of ALRI causing viruses detected during the study Monthly3 Monthly distribution of ALRI causing viruses detected during the study Page of 11 (page ... thiocyanate method [42] and 500 μl of NPA using RNeasy kit (Qiagen, GmBH, Germany) described previously [39] cDNA synthesis cDNA synthesis was optimized using 5–20 units of AMVRT enzyme, 500 ng ... from nucleocapsid region and for Influenza (A and B) from the matrix region using sequences available in GenBank, using program OLIGO (Molecular Biology Insights, Cascade, CO, USA, http://oligo.net)...
- 11
- 275
- 0
Báo cáo khoa học: "Impact of coccidial infection on vaccine- and vvIBDV in lymphoid tissues of SPF chickens as detected by RT-PCR" doc
... strain D78 and the virulent strain DK01, previously described [26] Coccidial strain and inoculation protocol E tenella oocysts from a Swedish field outbreak were kindly provided by Dr P Thebo, S.V.A., ... chamber under a microscope The dose of sporulated oocysts was adjusted to infect the birds without causing mortality [28] The optimal dose was decided according to results of the following preliminary ... registrations included clinical symptoms, pathology and serology Three chickTable 1: Inoculation protocol Number of chickens treated in each group Group Vaccination D78, day 21 Coccidia, day 24...
- 6
- 395
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... biological treatment facility by real-time PCR using the newly designed primer set and a TaqMan probe The specificity of new primers was investigated using PCR from six microcystin-degrading bacteria, ... dissolved in 100 µL of sterilized water PCR amplification PCR amplifications were conducted using modified protocols and the MF-MR and QMF-QMR primer sets described in Table New primers, QMF and ... Taq buffer, and µL of dNTP mixture, made up to a final volume of 50 - 195 - µL using pure water PCR was performed using a GeneAmp 2400 Thermocycler (Applied Biosystems Co., USA) The PCR reaction...
- 9
- 522
- 0
Cloning genes by PCR
... mRNAs are converted into cDNA using reverse transcriptase and an oligo-dT primer as described in Protocol 8.1 The generated cDNA can then be directly PCR amplified using a gene-specific primer and ... is subjected to reverse transcription using a gene-specific primer (GSP1) priming in the 5′ direction The resulting cDNA is tailed followed by amplification using a tail-specific primer and a nested ... available and have optimized protocols and reagents that work very efficiently These are relatively expensive but more time and money may be spent in optimizing the procedure using a series of independent...
- 24
- 271
- 0
Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx
... analysis Protein concentration was determined, as described previously [66], using BSA as a standard Proteins were precipitated using trichloroacetic acid and solubilized in 0.1% SDS and 0.1 m NaOH ... (final concentration) and analyzed using a Zeiss Axiovert 200M fluorescence microscope equipped with a 100· Plan oil-immersion objective Images were captured using a Zeiss AxioCam MRm CCD camera ... were extracted twice for 10 with shaking using 300 lL of chloroform ⁄ methanol (2 : 1; v ⁄ v), each The organic phases were combined and washed twice using methanol ⁄ water ⁄ chloroform (47 :...
- 12
- 699
- 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot
... immunoblotting, using antibodies as indicated As a negative control, the same cellular lysate was incubated with the NiNTA matrix without any bound protein, and the sample was subjected to the same protocol ... enzyme–substrate relationship and to determine whether the activity of Bud32p could be modulated by Sch9p Synthetic genetic interaction between BUD32 and SCH9 In order to find whether a functional relationship ... HAtagged Bud32p was immunoprecipitated from the same lysates used in (A) (500 lg of total protein), using the anti-HA resin Bound proteins were eluted with SDS ⁄ PAGE loading buffer, electrophoresed,...
- 15
- 414
- 0
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc
... assay was established using crude preparations from of BJ2168 (Table 1) and synthetic CCK-33 as substrate (Fig 1A) The nature of the protease performing the cleavage of synthetic human CCK-33 ... fluoroimmonoassay Statistics were performed using unpaired t-test (***P < 0.001 and **P < 0.01) protease assay using a crude extract of S cerevisiae to analyse the processing of synthetic human CCK-33 to CCK-22 ... were performed using the modified lithium acetate procedure as described [17] Analysis of expressed peptides/ Yeast genomic DNA was isolated as described [18] PCR was performed using either Pwo...
- 10
- 631
- 0
Báo cáo Y học: Acceleration of granulocyte colony-stimulating factor-induced neutrophilic nuclear lobulation by overexpression of Lyn tyrosine kinase docx
... resulting cell lines were selected using puromycin resistance The expression of Lyn and LynKN in the cell lines was con®rmed by immunoblotting the cell lysates using an anti-Flag IgG As shown in ... (GCGAATTCCGAGCGAGAAATATGGG) and internal primer Lyn-Nrev (AACTGCCCTGCGCCAAGC), while cDNA for C-terminal Lyn was ampli®ed using primers Lyn-Cfor (TCACTTTTCCCTGCATCAG) and Lyn-Crev (GCTCTAGACAATAGGCTAGTCTCC) The resultant ... which carries the puromycin-resistance gene, by electroporation (350 V pulse, 250 lF capacitance) using a Gene Pulsar II (Bio-Rad Laboratories, Hercules, CA, USA), essentially as described [39]...
- 9
- 274
- 0
Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc
... were detected using Western LightningÒ Western Blot Chemiluminescence Reagent Plus (Perkin-Elmer, Boston, MA, USA), following the manufacturer’s instructions, and by autoradiography using Kodak ... by an ELISA using a mouse G-CSF Quantikine ELISA kit (R&D Systems) according to the manufacturer’s instructions The levels of NO in the culture medium of RAW264.7 cells were measured using a Griess ... and b-actin were analyzed by western blotting (D) and the NO levels in the medium were determined using a Griess reagent system kit (E) The values for the LPS-treated cells were divided by those...
- 12
- 376
- 0
Báo cáo khoa học: Activation of the plasma membrane H+-ATPase of Saccharomyces cerevisiae by glucose is mediated by dissociation of the H+-ATPase–acetylated tubulin complex docx
... hydrophobic acetylated tubulin (HAT) by immunoblot, as described in the Experimental procedures, using antibody to total a-tubulin (left panel) and to acetylated tubulin (right panel) Fig Immunofluorescent ... and stained with antibody against acetylated tubulin (A), total a-tubulin (B), or H+-ATPase (C), using corresponding secondary antibodies conjugated to fluorescein for acetylated and total a-tubulin ... tubulin complex in membranes of glucose-starved yeast, we performed immunoprecipitation experiments using either anti-(acetylated tubulin) immunoglobulin or anti-(H+-ATPase) immunoglobulin bound to...
- 11
- 299
- 0
báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx
... magnetic cell separation (Miltenyi Biotech, Bergisch Gladbach, Germany) according to producers' protocols Cells were then cultured in RPMI 1640 supplemented with 100 μg/ml Kanamycin, 10 mM Hepes, ... refrigerators were not required RNA processing and Real Time PCR Total cellular RNA was extracted by using Ribo PureBlood kit (Ambion Inc., no AM1928, Austin, TX, USA) and eluted in 75 μl of elution ... Switzerland) Expression data were calculated, as referred to βactin gene expression in each sample, by using the −ΔC t method [22] For all genes analysed, dynamic linear range of expression-detection...
- 9
- 438
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... RN4220 (pCE107), respectively, using preparative isoelectric focusing as described previously [17-19] Other toxins used in this study were produced in recombinant form using SE genes cloned in this ... the validity of qRT-PCR is the efficiency of primers The primers used in qRT-PCR should have uniform and high efficiency to achieve a valid quantification The efficiency and linearity of primers ... extracted from approximately × 106 cells using Trizol (Life Technologies) Superscript II reverse transcriptase (Life Technologies) was used to generate cDNA using μg of RNA and oligo dT primer, according...
- 9
- 568
- 0
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
... screened for T pallidum using MACRO-VUE Rapid plasma Reagin (BD Biosciences, Oxford, UK) test kit and following manufacturer's protocol Positive samples were confirmed using a T pallidum haemagglutination ... probes were used in a single tube real time PCR using the QuantiTect probe kit (QIAGEN Ltd, Crawley, UK) with the following cycling conditions using either an Opticon (GRI/MJ Research, Braintree, ... DNA product and purity were checked by electrophoresis using a 2% agarose gel PCR products with no primer-dimers present were purified using Qiagen DNA mini-kits (QIAGEN Ltd, Crawley, UK) When...
- 10
- 458
- 0
báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf
... screened for T pallidum using MACRO-VUE Rapid plasma Reagin (BD Biosciences, Oxford, UK) test kit and following manufacturer's protocol Positive samples were confirmed using a T pallidum haemagglutination ... probes were used in a single tube real time PCR using the QuantiTect probe kit (QIAGEN Ltd, Crawley, UK) with the following cycling conditions using either an Opticon (GRI/MJ Research, Braintree, ... DNA product and purity were checked by electrophoresis using a 2% agarose gel PCR products with no primer-dimers present were purified using Qiagen DNA mini-kits (QIAGEN Ltd, Crawley, UK) When...
- 10
- 440
- 0
Báo cáo khoa học: "Detection of Lawsonia intracellularis in diagnostic specimens by one-step PCR" pot
... band pattern was analysed using an Eagle Eye II (Stratagene, U.S.A) according to the manufacturer's manual Cloning and sequencing of PCR product PCR product was purified using a GeneClean II kit ... µl of DNA template, and 0.5 unit of Taq Polymerase (Takara Co Japan) PCR reaction was performed using an automatized thermal cycler (Robocycler, Stratagene, U.S.A) The initial mixture was heated ... Jones et al [3] The ileal mucosa from pigs with PPE was scraped from the ileum and homogenized using a tissue grinder The homogenate was centrifuged at 750 g for 10 at room temperature, and...
- 5
- 288
- 0
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx
... plasmid DNA was purified using the Quantum Plasmid Miniprep Kit (Bio-Rad, USA) as per the manufacturer’s instructions Sequencing was performed by dideoxy termination using an ABI PRISM 3700 DNA ... products were electrophoresed in a 1% (w/v) agarose gel, stained with ethidium bromide and analyzed using a still video documentation system (Gel Doc 2000; Bio- Rad, USA) competent cells The recombinant ... termination using an ABI PRISM 3700 DNA Analyzer (Applied Biosystems, USA) Sequence data was analyzed using Chromas software version 1.51 (Technelysium, Australia) The homology searches were made at...
- 5
- 353
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25