effects of marine reserve protection at goat island northern new zealand
The information content of central bank interest rate projections: Evidence from New Zealand pot
... expectations aboutthe future path of the short-term rates. Therefore, starting with the Reserve Bank of New Zealand, several central banks have adopted a quantitative forward guidancestrategy ... interest rates in New Zealand. The role of interest rate projections for market expectations should be revealed by theresponse of futures rates. Irrespective of the projection horizon, we found that ... response of market expectations to interest rateprojectionsIn order to shed more light on the expectations management of the RBNZ, let us firstinvestigate how market expectations respond immediately...
- 32
- 419
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... investigate effects of Losartan on expression of connexin 40 and 43 (Cx40 and Cx43), in arteries at the early stage of atherosclerosis in a rabbit model. Methods: A total of 28 male New Zealand ... study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist Losartan on the Cx43 ... dis-ease induced activation of vessel wall cells. It is indi-cated that the expression of Cx43 in the smooth mus-cle cells was markedly elevated at the early stage of coronary atherosclerosis (3)....
- 8
- 467
- 0
Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants
... expected high levels of health consciousnesswill moderate the effect of menu labeling format suchthat highly health conscious individuals will derivelittle new information from calorie labels. ... information differed acrosstreatments. Diners in the control menu treatmentreceived no nutritional information, patrons in thecalorie-only menu treatment were provided the number of calories in parentheses ... bill. This legislation mandates chainrestaurants to provide calorie information on all menuforms [2]. While the intent of this type of labeling policyis quite clear, its effects are not. In...
- 9
- 420
- 0
the study enhancing the effects of english teaching by classroom eye contact at dong thap university
... way that phonology is often treated. Nonverbal communication is a system consisting of a range of features often used together to aid expression. The combination of these features is often ... communication in class. As stated above, with the intention to observe and the data collected, we can conclude that most of the teachers of English here at Dong Thap University have awareness of ... have contributed to the growth of aromatherapy and to a new profession of aromatherapists (Furlow, 1996). Because humans possess ―denser skin concentrations of scent glands than almost any...
- 73
- 489
- 0
current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010
... efficiency of AIDS patient care, support and treatment management in the adults’ outpatient clinics at the place of research. * New contributions of the thesis: - Describe operation situation of outpatient ... medicines and the rate of patients who did not received the preventive treatment. Diagram 3.5 Type of ARV treatment of the research patients before registering at the outpatient clinics. Among ... of ARV treatment, rates of the patients with the number of CD4 cells from 100 to 500 are : 76,5% and 82,5%. A number of the patients with the number of CD4 cells > 500 account for the rate...
- 27
- 364
- 0
study on effects of capitation payment method on cost and indicators of health insurance services at four district hospitals inthanh hoa province
... and communication. However, utilization of medical records is still one of the primary methods of evaluation. In healthcare, the expectations of patients on the quantity and quality of provided ... 3.13 shows that the growth rate of total healthcare cost of outpatients in hospitals adopting pilot capitation was lower than in those accepting FFS method. That difference was of statistical ... as their satisfaction, which may involve many things such as time of waiting, time of treatments, provider’s attitude, the result of the treatments, etc. 1.2.2.2. Indicators to evaluate healthcare...
- 29
- 369
- 0
Báo cáo khoa học: "Influence of gestational age at exposure on the prenatal effects of gamma-radiation" pps
... of Atomic Radiation. Genetic and somatic effects of ionizingradiation. pp. 263-366, United Nations, New York, 1986.37.UNSCEAR. Sources and effects of ionizing radiation.United Nation, New York, ... reducedafter exposure at this stage.The most common types of malformations resultingfrom gamma-irradiation were cleft palate, dilatation of thecerebral ventricle, dilatation of the renal pelvis ... Korea3Department of Pathology, College of Veterinary Medicine, Kyungpook National University, Taegu 702-701, KoreaThe objective of this investigation was to evaluate theinfluence of gestational age at exposure...
- 6
- 368
- 0
Báo cáo khoa học: "An ultrastructural study on cytotoxic effects of mono(2-ethylhexyl) phthalate (MEHP) on testes in Shiba goat in vitro" pptx
... of metabolites of di(2-ethylhexyl) phthalate, onimmature Shiba goat testes in vitro were examined. Thetestes of 2-month-old Shiba goats were cut into smallerpieces, and seeded in medium. At ... óMEHP at lowconcentration also affected co-cultured Sertoli cells fromneonatal rats [12].Although the in vitro model of immature Shiba goat testeswas sensitive to the treatment, no quantitative ... to examine the effects of MEHP onShiba goat testes. As a result, even a low concentration of MEHP caused permanent changes in testicular tissuecultures from immature Shiba goats. The result...
- 6
- 428
- 0
Báo cáo khoa học: "The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs" ppt
... Primer-F: CATTGCTGCTGGATTTACAGTTGMGB Probe: CGTAATTCTTAACTTCCTTPrimer-R: AGCATCCTGGAGAGATCAGCATNM213861IFN-γ Primer-F: AGCTCTGGGAAACTGAATGACTTCMGB Probe: AATTCCGGTAGATAATCTPrimer-R: TGATGAGTTCACTGATGGCTTTGX53085TNF-α ... TGATGAGTTCACTGATGGCTTTGX53085TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAGMGB Probe: TGTAGCCAATGTCAAAGCPrimer-R: GGCATTGGCATACCCACTCTM29079X54859β-actin Primer-F: CGACGGGCAGGTCATCACMGB Probe: CTGCGGCATCCACGAPrimer-R: ... evaluations Pigs were vaccinated s.c. with 1 dose of CSF vaccine at the beginning of the experiment, and received a booster 2 weeks later. Blood samples were collected from the vena cava of...
- 6
- 179
- 0
Báo cáo khoa học: "Protection of chicken against very virulent IBDV provided by in ovo priming with DNA vaccine and boosting with killed vaccine and the adjuvant effects of plasmid-encoded chicken interleukin-2 and interferon-g" doc
... adjuvants at day 18 of embryonation, and boosted with killed vaccine at 1 week of age. The chickens were challenged with vvIBDV at 3 weeks of age. After 10 days of observation, the mortality rate, ... hatchability rate of above 95%, indicating that the DNA vaccine did not affect embryo hatchability. The clinical signs of IBD (anorexia, depression, and ruffled feathers) began to appear at ... Stimulation index (SI) = (mean OD of ConA-stimulated cells) / (mean OD of unstimulated cells). Fig. 2. The size (A) and hematoxylin-eosin-stained sections (B) of the representative bursa of...
- 9
- 294
- 0
Báo cáo y học: "Anti-inflammatory effects of the gorgonian Pseudopterogorgia elisabethae collected at the Islands of Providencia and San Andrés (SW Caribbean)" potx
... number not for citation purposes)Journal of InflammationOpen AccessResearchAnti-inflammatory effects of the gorgonian Pseudopterogorgia elisabethae collected at the Islands of Providencia and ... centrifuged at 1250rpm at 4°C for 15 min. Triplicate 25 μl samples of theresulting supernatant were added to 96 well microtitreplates. For the assay, 125 μl of HBSS pH 7.4, 50 μl of PBSpH 5.4 ... (0.5 mg/ear)). Effects of extracts and fractions from P. elisabethae with respect to vehicle on MPO levels in supernatants of homogenates from TPA-treated earsFigure 3 Effects of extracts and...
- 10
- 373
- 0
Báo cáo y học: "Effects of dietary phytoestrogens on plasma testosterone and triiodothyronine (T3) levels in male goat kids" pdf
... testosterone concentrations in goat kids at the end of the experimentFigure 4Testicular testosterone concentrations in goat kids at the end of the experiment. Goat kids at the age of 3 months received ... testisTesticular cAMP concentrations in goat kids at the end of the experimentFigure 5Testicular cAMP concentrations in goat kids at the end of the experiment. Goat kids at the age of 3 months received either ... 4). Effects of phytoestrogens on the plasma testosterone con-centrations in male goat kidsFigure 1 Effects of phytoestrogens on the plasma testosterone concentrations in male goat kids. Goat kids at...
- 6
- 278
- 0
Báo cáo sinh học: "Non-additive effects of RBP4, ESR1 and IGF2 polymorphisms on litter size at different parities in a Chinese-European porcine line" pot
... Annealing temperature, MgCl2 concen-tration and amplification size are indicated for each fragment.Table 5: Results of association analysis of IGF2-intron3-G3072A SNP with litter size at different ... of permanent environmental effects for each sow with records in the last parity classbeing W the incidence matrix relating the elements of p≥6 with the records in y≥6. The expectation of ... genotype 22 was greater than that of sows grouped in the third class (ESR1 AA/RBP4 22 andESR1 BB/RBP4 11). The results of our joint associationanalysis allow us to corroborate more precisely...
- 10
- 213
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25