effects of marine reserve protection at goat island northern new zealand

Ngày tải lên: 24/11/2014, 02:27

Ngày tải lên: 13/08/2014, 08:21

... expectations about the future path of the short-term rates. Therefore, starting with the Reserve Bank of New Zealand, several central banks have adopted a quantitative forward guidance strategy ... interest rates in New Zealand. The role of interest rate projections for market expectations should be revealed by the response of futures rates. Irrespective of the projection horizon, we found that ... response of market expectations to interest rate projections In order to shed more light on the expectations management of the RBNZ, let us first investigate how market expectations respond immediately...

Ngày tải lên: 22/03/2014, 23:20

... investigate effects of Losartan on expression of connexin 40 and 43 (Cx40 and Cx43), in arteries at the early stage of atherosclerosis in a rabbit model. Methods: A total of 28 male New Zealand ... study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist Losartan on the Cx43 ... dis- ease induced activation of vessel wall cells. It is indi- cated that the expression of Cx43 in the smooth mus- cle cells was markedly elevated at the early stage of coronary atherosclerosis (3)....

Ngày tải lên: 26/10/2012, 09:39

Ngày tải lên: 07/09/2013, 13:48

... expected high levels of health consciousness will moderate the effect of menu labeling format such that highly health conscious individuals will derive little new information from calorie labels. ... information differed across treatments. Diners in the control menu treatment received no nutritional information, patrons in the calorie-only menu treatment were provided the number of calories in parentheses ... bill. This legislation mandates chain restaurants to provide calorie information on all menu forms [2]. While the intent of this type of labeling policy is quite clear, its effects are not. In...

Ngày tải lên: 08/04/2014, 18:33

... way that phonology is often treated. Nonverbal communication is a system consisting of a range of features often used together to aid expression. The combination of these features is often ... communication in class. As stated above, with the intention to observe and the data collected, we can conclude that most of the teachers of English here at Dong Thap University have awareness of ... have contributed to the growth of aromatherapy and to a new profession of aromatherapists (Furlow, 1996). Because humans possess ―denser skin concentrations of scent glands than almost any...

Ngày tải lên: 05/07/2014, 08:03

... efficiency of AIDS patient care, support and treatment management in the adults’ outpatient clinics at the place of research. * New contributions of the thesis: - Describe operation situation of outpatient ... medicines and the rate of patients who did not received the preventive treatment. Diagram 3.5 Type of ARV treatment of the research patients before registering at the outpatient clinics. Among ... of ARV treatment, rates of the patients with the number of CD4 cells from 100 to 500 are : 76,5% and 82,5%. A number of the patients with the number of CD4 cells > 500 account for the rate...

Ngày tải lên: 25/07/2014, 13:57

... and communication. However, utilization of medical records is still one of the primary methods of evaluation. In healthcare, the expectations of patients on the quantity and quality of provided ... 3.13 shows that the growth rate of total healthcare cost of outpatients in hospitals adopting pilot capitation was lower than in those accepting FFS method. That difference was of statistical ... as their satisfaction, which may involve many things such as time of waiting, time of treatments, provider’s attitude, the result of the treatments, etc. 1.2.2.2. Indicators to evaluate healthcare...

Ngày tải lên: 25/07/2014, 13:57

... of Atomic Radiation. Genetic and somatic effects of ionizing radiation. pp. 263-366, United Nations, New York, 1986. 37. UNSCEAR. Sources and effects of ionizing radiation. United Nation, New York, ... reduced after exposure at this stage. The most common types of malformations resulting from gamma-irradiation were cleft palate, dilatation of the cerebral ventricle, dilatation of the renal pelvis ... Korea 3 Department of Pathology, College of Veterinary Medicine, Kyungpook National University, Taegu 702-701, Korea The objective of this investigation was to evaluate the influence of gestational age at exposure...

Ngày tải lên: 07/08/2014, 14:23

... of metabolites of di(2-ethylhexyl) phthalate, on immature Shiba goat testes in vitro were examined. The testes of 2-month-old Shiba goats were cut into smaller pieces, and seeded in medium. At ... óMEHP at low concentration also affected co-cultured Sertoli cells from neonatal rats [12]. Although the in vitro model of immature Shiba goat testes was sensitive to the treatment, no quantitative ... to examine the effects of MEHP on Shiba goat testes. As a result, even a low concentration of MEHP caused permanent changes in testicular tissue cultures from immature Shiba goats. The result...

Ngày tải lên: 07/08/2014, 18:20

... Primer-F: CATTGCTGCTGGATTTACAGTTG MGB Probe: CGTAATTCTTAACTTCCTT Primer-R: AGCATCCTGGAGAGATCAGCAT NM213861 IFN-γ Primer-F: AGCTCTGGGAAACTGAATGACTTC MGB Probe: AATTCCGGTAGATAATCT Primer-R: TGATGAGTTCACTGATGGCTTTG X53085 TNF-α ... TGATGAGTTCACTGATGGCTTTG X53085 TNF-α Primer-F:GATCATCGTCTCAAACCTCAGATAAG MGB Probe: TGTAGCCAATGTCAAAGC Primer-R: GGCATTGGCATACCCACTCT M29079 X54859 β-actin Primer-F: CGACGGGCAGGTCATCAC MGB Probe: CTGCGGCATCCACGA Primer-R: ... evaluations Pigs were vaccinated s.c. with 1 dose of CSF vaccine at the beginning of the experiment, and received a booster 2 weeks later. Blood samples were collected from the vena cava of...

Ngày tải lên: 07/08/2014, 20:23

... adjuvants at day 18 of embryonation, and boosted with killed vaccine at 1 week of age. The chickens were challenged with vvIBDV at 3 weeks of age. After 10 days of observation, the mortality rate, ... hatchability rate of above 95%, indicating that the DNA vaccine did not affect embryo hatchability. The clinical signs of IBD (anorexia, depression, and ruffled feathers) began to appear at ... Stimulation index (SI) = (mean OD of ConA-stimulated cells) / (mean OD of unstimulated cells). Fig. 2. The size (A) and hematoxylin-eosin-stained sections (B) of the representative bursa of...

Ngày tải lên: 07/08/2014, 23:22

... number not for citation purposes) Journal of Inflammation Open Access Research Anti-inflammatory effects of the gorgonian Pseudopterogorgia elisabethae collected at the Islands of Providencia and ... centrifuged at 1250 rpm at 4°C for 15 min. Triplicate 25 μl samples of the resulting supernatant were added to 96 well microtitre plates. For the assay, 125 μl of HBSS pH 7.4, 50 μl of PBS pH 5.4 ... (0.5 mg/ear)). Effects of extracts and fractions from P. elisabethae with respect to vehicle on MPO levels in supernatants of homogenates from TPA-treated earsFigure 3 Effects of extracts and...

Ngày tải lên: 11/08/2014, 08:22

... testosterone concentrations in goat kids at the end of the experimentFigure 4 Testicular testosterone concentrations in goat kids at the end of the experiment. Goat kids at the age of 3 months received ... testis Testicular cAMP concentrations in goat kids at the end of the experimentFigure 5 Testicular cAMP concentrations in goat kids at the end of the experiment. Goat kids at the age of 3 months received either ... 4). Effects of phytoestrogens on the plasma testosterone con-centrations in male goat kidsFigure 1 Effects of phytoestrogens on the plasma testosterone concentrations in male goat kids. Goat kids at...

Ngày tải lên: 12/08/2014, 18:22

... Annealing temperature, MgCl 2 concen- tration and amplification size are indicated for each fragment. Table 5: Results of association analysis of IGF2-intron3-G3072A SNP with litter size at different ... of permanent environmental effects for each sow with records in the last parity class being W the incidence matrix relating the elements of p ≥ 6 with the records in y ≥6 . The expectation of ... genotype 22 was greater than that of sows grouped in the third class (ESR1 AA/RBP4 22 and ESR1 BB/RBP4 11). The results of our joint association analysis allow us to corroborate more precisely...

Ngày tải lên: 14/08/2014, 13:21

Ngày tải lên: 28/08/2014, 04:53

Ngày tải lên: 06/10/2014, 15:38

Ngày tải lên: 06/11/2014, 15:21

Ngày tải lên: 13/11/2014, 09:14