effects and noneffects of surgicalexperimentation on facial growth a personal retrospective

Báo cáo lâm nghiệp: " Effects of ectomycorrhizal inoculation and the type of substrate on mycorrhization, growth and nutrition of containerised Pinus pinea L. seedlings produced in a commercial nursery" docx

Báo cáo lâm nghiệp: " Effects of ectomycorrhizal inoculation and the type of substrate on mycorrhization, growth and nutrition of containerised Pinus pinea L. seedlings produced in a commercial nursery" docx

... peat Floratorf was purchased at Floragard (Oldenburg, Germany) and the vermiculite Termita®, grade at Asflatex S .A (Barcelona, Spain) Trays with 39 alveoles of 400 cm3 each (Forespot, La Fageda-Spain) ... solution of 20-719 Peters Professional Conifer Grower (Scott, Tarragona, Spain) Nursery production of containerised P pinea 819 Table II ANOVA significance levels for the factors inoculation (A) and ... production [36] The quality of a substrate for conifer production is directly related with its water retention capacity and the porosity [18], and usually a mixture of equal parts of sphagnum peat and...

Ngày tải lên: 08/08/2014, 00:22

6 510 0
The Impact of Education on Economic Growth Theory, Findings, and Policy Implications potx

The Impact of Education on Economic Growth Theory, Findings, and Policy Implications potx

... education in Korea and Taiwan as examples of subsidies of human capital accumulation that contributed toward dramatic increases in standards of living.72 Both nations raised their literacy rates ... a linear relationship between the log of earnings and the number of years of education.15 Second, we assume that the cost of an additional year of education equals the lost wages one might earn ... counted as a high school graduate In macroeconomic analysis, economists often include a variable for human capital Because human capital encompasses a range of characteristics such as education,...

Ngày tải lên: 17/03/2014, 08:20

30 1,1K 4
The imPact of high and groWing government debt on economic groWth an emPirical inveStigation for the euro area docx

The imPact of high and groWing government debt on economic groWth an emPirical inveStigation for the euro area docx

... the study are Australia, Austria, Belgium, Canada, Cyprus, Denmark, Finland, France, Germany, Greece, Ireland, Israel, Italy, Japan, Korea, Netherlands, New Zealand, Norway, Portugal, Spain, Sweden, ... the fact that private agents may anticipate inflationary pressures and/ or troubles in the financial markets and/ or transfer capital abroad As in Masson et al (1998), other factors that are found ... period of the analysis, as well as for economic and monetary regime changes, such as the creation of the monetary union and the introduction of the euro A list of the variables used in the various...

Ngày tải lên: 23/03/2014, 20:20

42 715 0
Báo cáo lâm nghiệp: "Improving RBS estimates – effects of the auxiliary variable, stratification of the crown, and deletion of segments on the precision of estimate" pps

Báo cáo lâm nghiệp: "Improving RBS estimates – effects of the auxiliary variable, stratification of the crown, and deletion of segments on the precision of estimate" pps

... [1]) and the true totals and variances of the target variables and the estimates of the totals, respectively Choice of the auxiliary variable and variance of the estimate As discussed above, ... clearly advantageous Stratification of the crown combined with the deletion of larger segments The stratification of the crown means a formation of at least two strata the size and variability of ... variable beyond a certain stage or segment and the conditional (and concomitantly, on the unconditional) selection probability of the segments of the paths Thus, path length variability (number of...

Ngày tải lên: 07/08/2014, 03:22

14 335 0
Báo cáo lâm nghiệp: "Diversity of endomycorrhizal fungi and their synergistic effect on the growth of Acacia catechu Willd." pot

Báo cáo lâm nghiệp: "Diversity of endomycorrhizal fungi and their synergistic effect on the growth of Acacia catechu Willd." pot

... colonization and plant growth due to the interchange of carbon, phosphate and nitrogen between the host fungi and bacteria According to Bader-El-Din and Moawad (1998), the dual inoculation of AM ... inoculations of symbionts showed significantly increased N-fixations growth and nutrient uptake in Leucaena leucocephala and Cajanus cajan (Sekhon et al 1992) The mutual association accounted ... enhances nodulation, yield and nitrogen fixation in chickpea (Cicer aritinum L.) Plant and Soil, 95: 351–359 REENA J., BAGYARAJ D.J., 1990 Response of Acacia nilotica and Calliandra calothyrus to...

Ngày tải lên: 07/08/2014, 04:20

8 368 0
Báo cáo y học: " Restriction by APOBEC3 proteins of endogenous retroviruses with an extracellular life cycle: ex vivo effects and in vivo "traces" on the murine IAPE and human HERV-K elements" pot

Báo cáo y học: " Restriction by APOBEC3 proteins of endogenous retroviruses with an extracellular life cycle: ex vivo effects and in vivo "traces" on the murine IAPE and human HERV-K elements" pot

... AAAAATTATACAAAATCCTCAGGAGTCATTCTCAGACTTTGTAGCTAGAATGACAGAGGCAGCAGGCAGAATTTTTGGAGACTCTGAACAGGCAATGCCT .A A A A AA .A ... A HERV-K 7350 7370 7390 7410 7430 ACATGGTAAGCGGGATGTCACTCAGGCCACGGGTAAATTATTTACAAGACTTTTCTTATCAAAGATCATTAAAATTTAGACCTAAAGGGAAACCTTGCCC ch1-1539 ch1-1590 ch3-1029 ch3-1143 ch3-1271 ... The APOBEC3 expression plasmids were obtained from M Malim (hA 3A) , the NIH AIDS Research and Reference Reagent program (hA3B, hA3C and hA3F), Open Biosystems (hA3DE), A Hance (hA3G), and N Landau...

Ngày tải lên: 13/08/2014, 05:21

11 277 0
Báo cáo y học: " The paradoxical effects of splenectomy on tumor growth" pot

Báo cáo y học: " The paradoxical effects of splenectomy on tumor growth" pot

... chemical sarcogenesis among mice of a single highly inbred strain The earlier appearance of a methylcholanthrene-induced sarcoma in one animal of a pair marked that mouse as having about a 70% chance ... cellular aggregation can determine and control the growth and differentiation of cells both in vitro and in vivo [4] One may speculate that the varied effects on tumor growth produced by varied ... the absence of a blood transfusion In a somewhat analogous mouse experiment, I found that a large allogeneic blood transfusion profoundly stimulated the growth of, in this case, a transplantable...

Ngày tải lên: 13/08/2014, 23:20

6 391 0
Báo cáo sinh học: " Effects of the number of markers per haplotype and clustering of haplotypes on the accuracy of QTL mapping and prediction of genomic breeding values" pot

Báo cáo sinh học: " Effects of the number of markers per haplotype and clustering of haplotypes on the accuracy of QTL mapping and prediction of genomic breeding values" pot

... influence on the considered trait All mutated QTL alleles received an effect drawn from a gamma distribution (with a shape parameter of 0.4 and scale parameter of 1.0), with an equal chance of being ... was: matrix based on the pedigree of the last four generations of animals and s G is the polygenic variance The esti- mated haplotype variance at each locus was calculated as y i = m + animal ... steps as for base haplotypes, but only considering a value for limitIBD of 0.95 Evaluation of analyses Each simulated dataset and model analysis was replicated ten times for limitIBD of 0.75 and...

Ngày tải lên: 14/08/2014, 13:21

10 281 0
Characterisation of the effects and mechanism of action of rapamycin and genistein on acute myeloid leukemia using high throughput techniques

Characterisation of the effects and mechanism of action of rapamycin and genistein on acute myeloid leukemia using high throughput techniques

... to cations by the gain of a proton The ions are sorted and separated according to their mass and charge The separated ions are then detected and tallied, and the results are displayed on a chart ... probes arranged as an array on a solid surface to interrogate the abundance and/ or binding ability of DNA or RNA target molecules The DNA probes that are used in a DNA microarray are usually amplified ... biological perturbations such as disease or drug treatment (Anderson and Anderson, 1998) In many cases, transcriptomic data are not enough for a clear identification of a therapeutic target, mainly...

Ngày tải lên: 11/09/2015, 09:18

202 319 0
Effects of impurities on crystal growth processes

Effects of impurities on crystal growth processes

... equation, crystal growth rates vary from a parabolic dependence on supersaturation to a linear dependence as the supersaturation increases (Davey and Garside, 2000) Growth rate measurements as a ... of conditions The speciation depends on both solvent and pH and can be calculated from the measured pKa values of the acid and base (Jones et al., 2005) Of the many factors controlling crystal ... (Shekunov and York, 2000) Nevertheless, traditionally, crystallization has often been regarded as a “low-tech” area of chemical production Because of this, industrial crystallization as a large scale...

Ngày tải lên: 12/09/2015, 08:18

197 2,1K 0
The noneffects of class on the gendered division of labor in the home

The noneffects of class on the gendered division of labor in the home

... when I began the analysis Indeed, as part of my general agenda of class analysis, I was initially quite bent on demonstrating that class was a signi®cant part of the explanation of variations in ... highly egalitarian and inegalitarian households ± rather than to the distribution as a whole None of these manipulations of the data changed the essential contours of the results: class location is ... of variations across households to the more institutional issue of the relationship between the political mobilization of classes on the one hand and gender relations on the other One might argue...

Ngày tải lên: 01/11/2013, 07:20

13 622 0
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

... effectiveness of state laws, and lack of harmonization at the international level a number of states have started to block access to websites and social media platforms that allegedly contain illegal content ... participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Georgia, Germany, Greece, ... disadvantages of various international and national content regulation measures – particularly vis-à-vis fundamental rights of free expression and media freedom and 3) by taking into account international...

Ngày tải lên: 18/02/2014, 00:20

238 2,7K 0
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx

Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx

... concentration, we measured the concentration of free cytosolic Ca2+ at different VtA3 concentrations and different incubation times as shown in Fig At increasing VtA3 concentrations and incubation ... suspension, bandwidths of nm for excitation and nm for emission, and excitation and emission wavelengths of 360 and 500 nm, respectively Mitochondrial transmembrane potential Mitochondrial transmembrane ... only at relatively low viscotoxin concentration as concentrations greater than lm always led to seal breakdown Pyrularia thionin 78 and b-purothionin are also capable of lysing cell membranes,...

Ngày tải lên: 19/02/2014, 07:20

12 530 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx

Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx

... 5¢-450 AAAAATGTTGCTGCCCTG-3¢ 5¢-566 GAATGACTCGGAGCGTACACTG-3¢ 5¢-1054 CCTTTGAGCACATTTCGGCAA-3¢ 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ 5¢-1821CAAGGGTAAATTCATTGGGCTTGG-3¢ 5¢-2350 ACAGACTACCTCATGAAGAT-3¢ ... PCR ampli®cation Target cDNA Localization and sequence of primer Size of PCR products (bp) Syndecan-1 5¢-370 AGGTGCTTTGCCAGATATGACT-3¢ 5¢-802 CTCTTTGATGACAGAAGTGCCT-3¢ 5¢-85 GAGTCGATTCGAGAGACTGA-3¢ ... Meroni, S.B., Capena, D.F., Pellizzari, E.H & Cigorraga, S.B (1999) E€ects of basic ®broblast growth factor and nerve growth factor on lactate production, c-glutamyl transpeptidase and aromatase...

Ngày tải lên: 21/02/2014, 03:20

10 625 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

... Best managers will not choose ABC which takes times, money and personnel to adopt into this kind of companies In conclusion, manufacturing capability are and criteria and standards for managers ... decisions by using SWOT analysis and survey results 2.1.1 History of cost accounting methods and ABC general review A fire at the headquarters of the National Association of Accountants (NAA) in ... Plant-level control variables Based on the analysis above, there are six control variables that the author wants to analyze to clarify the correspondence between ABC and the manufacturing capability...

Ngày tải lên: 13/03/2014, 14:19

64 512 0
research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam

research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam

... assessment of and reporting on areas on the hospital’s activities that have a social impact” The basing of environmental and social accounting had increased the complexity of the traditional view ... standards of the Nestle Group, the international standard ISO - 14001:2004 The company has investment the construction and installation of wastewater treatment plant, treatment the sewage of coffee ... CSR as a part of important to determine the cost, progress and the quality of an enterprise Because of CSR can create the competitive advantage, there are many giant corporations can pay a lot of...

Ngày tải lên: 13/03/2014, 14:20

73 706 2
RCUK Policy and Code of Conduct on the Governance of Good Research Conduct pptx

RCUK Policy and Code of Conduct on the Governance of Good Research Conduct pptx

... documentation and par ticipant consent Falsification This includes the inappropriate manipulation and/ or selection of data, imagery and/ or consents Plagiarism This includes the general misappropriation ... organisation, and may also be passed to any appropriate regulatory or professional supervisory body Imposition of sanctions and penalties • Guidance on possible appropriate sanctions for various ... clear guidance on what is acceptable and not acceptable in line with the RCUK Code of Conduct and those of other relevant professional bodies; • be drawn to the attention of all staff on appointment;...

Ngày tải lên: 24/03/2014, 02:20

16 390 0
Báo cáo khoa học: Analysis of the region for receptor binding and triggering of oligomerization on Bacillus thuringiensis Cry1Aa toxin potx

Báo cáo khoa học: Analysis of the region for receptor binding and triggering of oligomerization on Bacillus thuringiensis Cry1Aa toxin potx

... R3 11C-AS, 5¢-AATAATTAAAGCCACAATGCACATCAGT AT-3¢; S373C-S, 5¢-AATTATACTTGGTTGTGGCCCAA ATAATCA-3¢; S373C-AS, 5¢-TGATTATTTGGGCCACA ACCAAGTATAATT-3¢; N376C-S, 5¢-TTGGTTCAGGCC CATGTAATCAGGAACTGT-3¢; ... R281C-AS, 5¢-TCTGAGCCATTCCACA AAAACTACCATCAA-3¢; Q293C-S, 5¢-ACCAGAATATT AGGTGTCCACATCTTATGGA-3¢; Q293C-AS, 5¢-TCC ATAAGATGTGGACACCTAATATTCTGT-3¢; R311C-S, 5¢-ATACTGATGTGCATTGTGGCTTTAATTATT-3¢; ... CATGTAATCAGGAACTGT-3¢; N376C-AS, 5¢-ACAGTT CCTGATTACATGGGCCTGAACCAA-3¢; G442C-S, 5¢TGAGCCAAGCAGCTTGTGCAGTTTACACCT-3¢; G44 2C-AS, 5¢-AGGTGTAAACTGCACAAGCTGCTTGGCT CA-3¢; Y445C-S, 5¢-AGCTGGAGCAGTTTGTACCTTGA GAGCTCC-3¢;...

Ngày tải lên: 29/03/2014, 22:21

11 588 0

Bạn có muốn tìm thêm với từ khóa:

w