... instuctions Total RNA was digested with RNAase-free DNase I (TaKaRa Carlsbad, CA, USA) at 37°C for 30 and inactivated at 60°C for 10 With total RNA (2 lg) as the template and oligo(dT) as the primer, ... exclude the DNA contamination cDNA template (3 lL) was used in a 25 lL reaction volume with rTaq DNA polymerase or LA TaqTM DNA polymerase with GC buffer (TaKaRa) Human NANOGP8 mRNA was amplified by ... cloned and sequenced, the results indicated that NANOGP8 was expressed in human osteosarcoma cell line OS732, human hepatoma cell line HepG2 and human breast adenocarcinoma cell line MCF-7 (Table...
Ngày tải lên: 07/03/2014, 12:20
... Expression can then be readily detected in a liquid assay for β-galactosidase and read in a plate reader Analysis was done in the context of a 96 well plate and the cells were infected with a 2-fold ... cells also contain a stably integrated copy of the β-galactosidase (β-gal) gene downstream of the HIV-1 long terminal repeat (LTR) Upon infection, the HIV transactivator protein Tat activates β-gal ... analysis reveals that an analogous "temperature arrested state" can be generated for virion-cell fusion and that it is an intermediate in the process leading to HIV infection Results To determine...
Ngày tải lên: 20/06/2014, 01:20
DNA evidence is a frozen moment in time pdf
... •Ideal annealing temperature can be mathematically estimated It should be just 1-2 C below Tm Tm = (4 x [G+C]) + (2 x [A+ T]) • GATCTACCACTGATA ATACGTATCTAGTTA GCTCGGGGCATGCC DNA Quality DNA should ... should be intact and free of contaminants that inhibit amplification • Contaminants can be heme from blood, humic acid from soil and melanin from hair • Contaminants can be introduced during the ... consists of a DNA denaturation step, a primer annealing step and a primer extension step • DNA Denaturation: Expose the DNA template to high temperatures to separate the two DNA strands and allow...
Ngày tải lên: 07/07/2014, 18:20
Báo cáo khoa học: "Thickness of cumulus cell layer is a significant factor in meiotic competence of buffalo oocytes" potx
... nuclear material was scattered in the ooplasm indicating spindle damage Statistical analysis Data for meiotic development of oocytes among all groups was analyzed by chi square procedure using Statistix ... In vitro production of blastocyst in goats, sheep and buffaloes Indian J Anim Sci 1997, 65, 394-396 Chauhan MS, Singla SK, Palta P, Manik RS, Madan ML In vitro maturation and fertilization, and ... University of Minnesota, Saint Paul, USA and Dr Muhammad Aleem Bhatti, Associate Professor, Department of Theriogenology, University of Veterinary and Animal Sciences, Lahore, Pakistan for their...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo y học: " Media and education play a tremendous role in mounting AIDS awareness among married couples in Bangladesh" potx
... of mass media such as radio, TV is very limited in Bangladesh especially in rural areas as compared to urban areas, some additional programs such as face-to-face communication and sexual education ... study has aimed to examine the association between AIDS awareness and a set of independent variables The set of independent variables are women educational attainment, current engagement in an income ... implementation, monitoring and evaluation regarding AIDS awareness In this regards a few national and international researchers have made attempts to understand the reasons and come up with some explanations...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" pptx
... indwelling arterial or venous catheter Plasma was separated from the blood samples at the time of blood draw and frozen at 70°C until assayed Measurement was done in a blinded manner as a batch analysis ... infarction (12), heart failure (11), pulmonary embolism (2) haemorrhagic shock (1) 26 Abdominal Gastrointestinal bleeding (7), abdominal infection (6), urinary tract infection (5), acute renal ... analysis Mid-regional pro-ANP (epitopes covering amino acids 53–90) was detected in EDTA plasma from all patients with a new sandwich immunoassay (BRAHMS Seristra® LIA; BRAHMS AG, Hennigsdorf/Berlin,...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: "Free does not mean affordable: maternity patient expenditures in a public hospital in Bangladesh" pot
... or nonpaying by observing the clothes and general appearance of the woman and any accompanying relatives Non-paying patients pay only the hospital admission fee Paying inpatients are charged the ... non-paying and paying Patients first go to an out-patient unit for diagnosis where they are categorized as out- or in- patient Those categorized as in- patient are then classified as paying or nonpaying ... Variables Information was collected on various characteristics of the study participants Demographic characteristics included age, education, marital status, and residence Socio-economic characteristics...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Assessment of efficacy and impact on work productivity and attendance after a mandatory switch to generic second-generation antihistamines: results of a patient survey in Norway" pdf
... dissatisfaction with loratadine BMC Fam Pract 2003, 4:10 Prenner BM, Capano D, Harris AG: Efficacy and tolerability of loratadine versus fexofenadine in the treatment of seasonal allergic rhinitis: ... second-generation antihistamines, raising the issue of whether a mandated switch in treatment is ethically acceptable in patients well controlled by or satisfied with their treatment Clinical management ... All authors read and approved the final manuscript Competing interests Medical writing and editorial assistance was provided by Carol Sibley and Patricia C Abramo of AdelphiEden Health Communications,...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: " Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary" potx
... release at the NAc Gabapentin is a gamma-aminobutyric acid (GABA) analogue, with GABAmimetic pharmacological properties Gabapentin is used for the treatment of seizures, anxiety and neuropathic ... increase (approximately 50%, p < 0.05) in extracellular NAc GABA levels, but failed to alter either basal or cocaine-enhanced NAc DA These data suggest that Gabapentin is a weak GABA-mimic drug At the ... hunger and withdrawal against advice rate of cocaine abusers in a 30 day inpatient treatment program with the neuronutrient tropamine Curr Ther Res 1988; 43:1204 Alcohol and Cocaine SAAVE and Tropamine...
Ngày tải lên: 13/08/2014, 16:21
Endofin is a novel component in EGR EGFR oncogenic signaling
... as actin-driven macropinocytosis and phagocytosis, dynamin-dependent caveolin-1 associated caveolar endocytosis, a CIE pathway that involves CDC42, ADP-ribosylation factor (ARF1), actin and another ... glycosylated, extracellular N-terminal region (621 amino acids), a transmembrane segment (amino acids 622-644), followed by an intracellular domain that contains a juxtamembrane region, a tyrosine kinase ... by APPL and this in turn may affect the intensity of MAPK signaling 1.8 FYVE domain-containing proteins A group of proteins that are also implicated in EGFR trafficking and signaling are the...
Ngày tải lên: 11/09/2015, 10:00
Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion
... potentiate adjuvant therapy It is likely that the chemoresistance properties are potentiated by autocrine and paracrine pathways and facilitated by mitogenic agents Local tissue invasion distinguishes ... nuclear atypia, increased mitotic activity, vascular thrombosis, microvascular proliferation and necrosis Similar to anaplastic astrocytoma, glioblastoma may arise de novo as glioblastoma or may ... Polynesian Islanders have higher incidence rates than Caucasian New Zealanders In contrast, African Americans have a lower incidence than White Americans in the United States (US) Jews living in the Israel...
Ngày tải lên: 14/09/2015, 12:13
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps
... miR-145 3' UUCCCUAAGGACCCUUUUGACCUG |||||||||| Mouse 5' CUUGAAGAGAUAAGAAAACUGGAU Human 5' CUUGAAGGGAAGACAAAACUGGAU Rat 5' UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' ... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... |||||| 5' UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed...
Ngày tải lên: 11/08/2014, 12:20
SERVICE QUALITY, PERCEIVED PRICE AND CUSTOMER SATISFACTION IN HIGHER EDUCATION A comparison between Public Universities and Non-public Universities in Vietnam
... Non-academic aspects scale Nacdm1 When I have a problem, administrative staff show a sincere interest in solving it Nacdm2 Administrative staff provide caring and individual attention Nacdm3 Inquiries/complaints ... as below Table 4.3 (Appendix 4.1) Table 4.3 - EFA analysis result Nacdm1 Nacdm2 Nacdm3 Nacdm4 Nacdm5 Nacdm6 Nacdm7 Nacdm8 Acadm1 Acadm2 Acadm3 Acadm4 Acadm5 Acadm6 Acadm7 Acadm8 Reptt1 Reptt2 ... positive attitude towards students Acadm6 Academic staff communicate well in the classroom Acadm7 Academic staff has a precise method to appraise my studying performance Acadm8 Academic staff are...
Ngày tải lên: 01/06/2015, 20:20
Who is a stream epistemic communities, instrument constituencies and advocacy coalitions in public policy making 1 2
... framing a problem in a particular fashion rather than some other This lack of a detailed conception of agency in Kingdon’s original model has left a significant gap in existing work based on his ... subsystem is an appropriate unit of analysis for distinguishing the actors involved in the politics, process and problem aspects of policy-making activities such as agenda-setting in which informal interactions ... in each “stream” This is a useful insight in itself and brings new light to the discussion of agenda-setting dynamics Kingdon focused upon However it is also an advance on his thinking in that...
Ngày tải lên: 22/09/2015, 15:18
Who is a stream epistemic communities, instrument constituencies and advocacy coalitions in public policy making 1
... additional streams emerge that can become apparent through and beyond agenda setting, such as those involved in operational administrative processes once a problem has been established during agenda ... coalitions, wax and wane as solution-based activity occurs, being actively engaged in formulation, less so in decision-making and then again actively involved in implementation and evaluation Conclusion: ... developed in the international relations literature to describe groups of scientists involved in articulating and delimiting problem spaces in areas such as oceans policy and climate change (Haas 1989,...
Ngày tải lên: 22/09/2015, 15:18
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... necessary NACA Development of vital (life threatening) danger possible NACA Acute vital (life threatening) danger NACA Acute cardiac or respiratory arrest NACA Death NACA score as a routine for ... each incident (not the individual patient) The AMIS form contains basic information about the situation, the patient(s), all available logistics (date, time registration for incoming alarm and ... Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund We want to thank Pål Renland for valuable help in data coding,...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table ... decreased in our patients This finding is in apparent contrast to normal admission levels of Ang-1 in the aforementioned studies [22,23] We assume that a decline in circulating Ang-1 is not an early ... survival in our cohort of medical ICU patients using a multivariate Cox model In a large trauma cohort study [22], Ang2 correlated with mortality in a univariate analysis In a surgical population...
Ngày tải lên: 25/10/2012, 10:31