edmunds elizabethm c 1941— american nun naval officer and doctor

Lập trình hướng đối tượng tren C/C++ - OOP 06 the STL library and encapsulation

Lập trình hướng đối tượng tren C/C++ - OOP 06 the STL library and encapsulation

... m c đ nh đa th c = Kh i t o v i b c m ng h s cho trư c c Kh i t o t m t đ i tư ng đa th c kh c kh c H y đa th c, thu h i b nh c, (Nhóm truy xu t thông tin) L y b c đa th c c L y h s t i b c ... functions Thư vi n STL L p string (header ): L p đ i di n cho chu i ký t Gi i quy t v n đ tr C c phương th c chính: chính: Phương th c Ý nghĩa string(char *) Kh i t o t m t chu i char ... vector m_danhSach; vector m_danhSach; }; 18 Tóm t t Thư vi n C+ +: B c ng c d ng s n h tr l p trình C+ + C c thư vi n ph bi n: n: Thư vi n chu n: n: Thư vi n boost Thư vi n MFC Thư vi n STL:...

Ngày tải lên: 12/01/2014, 16:57

24 443 7
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... mLÆmin)1 and detected using an RI detector Chito-oligomers and GlcNAc were used as standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path ... speci c activity of pronase indicated that chitosan dissolved in aqueous acetic acid (1%) and was the best solvent when compared to formic and lactic acids In acetic acid, being a weak acid (see...

Ngày tải lên: 19/02/2014, 12:20

11 674 0
Treatment of Tuberculosis - American Thoracic Society, CDC, and Infectious Diseases Society of America doc

Treatment of Tuberculosis - American Thoracic Society, CDC, and Infectious Diseases Society of America doc

... tuberculosis in high-incidence, low-income countries It is important to recognize that the American Thoracic Society/CDC/Infectious Diseases Society of America (ATS/ CDC/IDSA) recommendations cannot ... References DuMelle FJ, Hopewell PC The CDC and the American Lung Association /American Thoracic Society: an enduring public/private partnership In: Centers for Disease Control and Prevention: a century ... primary and referral services and cooperation between clinicians and public health officials, between health care facilities and community outreach programs, and between the private and public sectors...

Ngày tải lên: 06/03/2014, 04:20

88 598 0
Recommendations from the American Thoracic Society, CDC, and the Infectious Diseases Society of America docx

Recommendations from the American Thoracic Society, CDC, and the Infectious Diseases Society of America docx

... Settings Conventional contact investigations have used the concentric circles approach to collect information and screen household contacts, coworkers, and increasingly distant contacts for TB infection ... Maintaining Clinical and Public Health Expertise in an Era of Declining TB Incidence Detecting a TB case, curing a person with TB, and protecting contacts of such persons requires that clinicians and ... resources from CDC-funded national TB centers, NIH-supported TB curriculum centers, NTCA, and other national and local agencies to create and implement education activities in coordination with schools...

Ngày tải lên: 06/03/2014, 04:20

84 847 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

... CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA forward, CCTATGAGCACCTGACCACA reverse, AGGCCACTGACTAGGCTGAA forward, GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA forward, ACCTGCTACAACCCCCTCTT reverse, ... CTGCTCCTTCTCCTTCATGC forward, TACAACCACAAGGCGCTACA; reverse, AAGGGCCTGACTCCATAGGT forward, CAGGAAGAACCGTTGGAGTT; reverse, TTGCTCTCGTTCCAAAAGGA forward, AAGGAAGGCTGGAAAAGAGC reverse, TACAGCTTCACCACCACAGC ... TACAGCTTCACCACCACAGC forward, TTTGATGCAGGTGTTTGAGG reverse, CCACCTGTAGGTCTGGCA forward, CCTTGCCCTACAGCTGAGTC reverse, CTTGTCTTCTGTGCCTGTGC forward, GTTTGAATTGGCCAGAGGAA reverse, TCTGTTGGAAAATCCCGTTC forward,...

Ngày tải lên: 07/03/2014, 03:20

12 561 0
CROSSED SWORDS A Canadian-American Tale of Love and Valor docx

CROSSED SWORDS A Canadian-American Tale of Love and Valor docx

... left was carried by Sir Guy Carleton, the commander of the Canadian forces, the other by an officer under Colonel Benedict Arnold's command As the two rusty and trusty old blades now lie peacefully ... Firesides of French Canada," etc., etc TORONTO WILLIAM BRIGGS 1912 Copyright, Canada, 1912, by MARY W ALLOWAY TO CANADIAN AND AMERICAN WOMEN WHO LOVE THEIR COUNTRY'S HEROIC PAST INTRODUCTION This tale ... he could scarce control, exclaimed: "With men of such spirit under my command, our king need have no concern for his royal supremacy in these provinces I have affairs of moment to arrange and...

Ngày tải lên: 08/03/2014, 18:20

156 383 0
RFF report American Patent Policy,Biotechnology, and African Agriculture: The Case for Policy Change

RFF report American Patent Policy,Biotechnology, and African Agriculture: The Case for Policy Change

... producers and users of technological knowledge and in a manner conducive to social and economic welfare, and to a balance of rights and obligations Article 8.1 specifically recognizes that countries ... Patents and Patent Policy and the Case for Change 47 Impacts of U.S Patents and Patent Policy 47 The Case for Policy Change 51 chapter six: Analyzing and Changing American Patent Policy 56 Framework ... system and patent policies — domestic and foreign — affect access to biotechnology for developing country food-security purposes, and we sketch the case for policy change ı ı ı 46 American Patent...

Ngày tải lên: 13/03/2014, 22:07

127 323 0
C++ Programs to Accompany Programming Logic and Design pot

C++ Programs to Accompany Programming Logic and Design pot

... cycle, which includes creating a source code file, compiling the source code, and executing a C+ + program AN INTRODUCTION TO C+ + AND THE C+ + PROGRAMMING ENVIRONMENT You should the exercises and ... Each section of each chapter includes meaningful paper and pencil exercises that allow students to practice the skills and concepts they are learning in the section Labs: Each section of each chapter ... INTRODUCTION TO OBJECT-ORIENTED TERMINOLOGY THE STRUCTURE OF A C+ + PROGRAM THE C+ + DEVELOPMENT CYCLE Writing C+ + Source Code Compiling A C+ + Program Executing A C+ + Program Exercise 1-1: Understanding...

Ngày tải lên: 14/03/2014, 11:20

224 916 1
Báo cáo khoa học: Specific biomarkers for stochastic division patterns and starvation-induced quiescence under limited glucose levels in fission yeast docx

Báo cáo khoa học: Specific biomarkers for stochastic division patterns and starvation-induced quiescence under limited glucose levels in fission yeast docx

... glucose concentrations (E) Micrographs of cells cultured in different glucose concentrations (F) Micrographs of cells in the same microscope field at h (top) and 48 h (bottom) in culture medium containing ... fasting condition Certain biosynthetic precursor compounds, such as UDP-glucose, acetyl-CoA and phosphoglyceric acid, were virtually absent in mm glucose, like ATP and other high-energy compounds, ... the manufacturer’s instructions Microscopy and movies Cells were cultivated in 111 mm glucose medium to logarithmic phase (2 · 106 cellsÆmL)1), and then fixed in a microscopic specimen chamber that...

Ngày tải lên: 14/03/2014, 23:20

17 272 0
C++ Programs to Accompany Programming Logic and Design potx

C++ Programs to Accompany Programming Logic and Design potx

... cycle, which includes creating a source code file, compiling the source code, and executing a C+ + program AN INTRODUCTION TO C+ + AND THE C+ + PROGRAMMING ENVIRONMENT You should the exercises and ... Each section of each chapter includes meaningful paper and pencil exercises that allow students to practice the skills and concepts they are learning in the section Labs: Each section of each chapter ... INTRODUCTION TO OBJECT-ORIENTED TERMINOLOGY THE STRUCTURE OF A C+ + PROGRAM THE C+ + DEVELOPMENT CYCLE Writing C+ + Source Code Compiling A C+ + Program Executing A C+ + Program Exercise 1-1: Understanding...

Ngày tải lên: 14/03/2014, 23:20

224 2,2K 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

... splice variants exhibited positive cooperativity in speci c activity, with Hill coefficients of 2.4 and 1.9 and dissociation constants (KdHill) of and lm for hGBP5a ⁄ b and hGBP5ta, respectively ... (filled circles) and mant-GTPcS (open circles) association are plotted against the protein concentration (C) Observed association rates of mant-GTP with hGBP5a ⁄ b (open circles) or hGBP5ta (filled circles) ... increase in speci c GTPase activity and increased formation of GMP during hydrolysis Thermodynamics and stoichiometry of nucleotide binding We used ITC to investigate the thermodynamics of nucleotide...

Ngày tải lên: 15/03/2014, 10:20

9 462 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

... CS060# and CS#60# Residue Carbon CS040# (p.p.m.) CS060# (p.p.m.) CS#60# (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 102.83 71.54 67.51 109.41 147.01 – 102.97 55.02 ... of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and C2 of GlcA ... GalNAc residue Table Carbon chemical shift Dd values between CS040# and CS060# Residue Carbon Calculated (p.p.m.) Observed (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 +1.1 +0.9 +1.2 +0.6 +0.4...

Ngày tải lên: 16/03/2014, 14:20

11 481 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGTCTGCCCTGACTCAGCCTGC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo " Criticizing behaviors by the Vietnamese and the American: topics, social factors and frequency " docx

Báo cáo " Criticizing behaviors by the Vietnamese and the American: topics, social factors and frequency " docx

... topics of criticism, frequency of criticizing and factors that affect people’s decision to criticize and their criticizing behaviors may also vary across cultures, influenced by specific cultural ... that affect the pragmalinguistic decisions in performing the speech act of criticizing, the common criticism topics, and the frequency of the speech act by the Vietnamese and the American The ... the Americans opt out of criticizing consolidates the fact that Americans highly value individualism, the central characteristics of which being “non-interference”, “privacy” [31], and “self-face...

Ngày tải lên: 28/03/2014, 11:20

14 396 0
scientific american   -  1997 08  -  age and energy

scientific american - 1997 08 - age and energy

... by Scienti c American, Inc., to libraries and others registered with the Copyright Clearance Center (CCC) to photocopy articles in this issue of Scienti c American for the fee of $3.50 per copy ... D .C icy is Richard N Zare, a chemist at Stanford University money talks 16 Scientific American August 1997 Copyright 1997 Scientific American, Inc News and Analysis SCIENCE AND THE GEOPHYSICS ... Linnéa C Elliott, DIRECTOR JOHN RENNIE, Editor in Chief editors@sciam.com Electronic Publishing Martin O K Paul, DIRECTOR Ancillary Products Diane McGarvey, DIRECTOR Scientific American, Inc 415...

Ngày tải lên: 12/05/2014, 15:29

77 476 0
scientific american   -  1999 06  -  scanners and scalpels

scientific american - 1999 06 - scanners and scalpels

... Research Council (NRC) Recent studies have shown that U.S students have a poor understanding of basic scientific principles and their relation to everyday life Currently science and technology courses ... the balence Foundation estimates that one third of all Ph.D science ance between national security and open science — Philip Yam 14 Scientific American June 1999 News and Analysis SCIENCE AND THE ... MANAGER Constance Holmes, MANAGER, ADVERTISING ACCOUNTING AND COORDINATION Electronic Publishing Martin O K Paul, DIRECTOR Ancillary Products Diane McGarvey, DIRECTOR Chairman John J Hanley Co-Chairman...

Ngày tải lên: 12/05/2014, 15:57

84 502 0
scientific american   -  2003 11  -  strings and spacetime with 11 dimensions

scientific american - 2003 11 - strings and spacetime with 11 dimensions

... SCIENTIFIC AMERICAN COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC 43 AT AT COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC TGGGATAGCGACGAGCCAGTCTGCTCTAGACAGACGTAGCATATGGGATAGCGACAGACAGACGTAGCATATGGGAG FLECKS OF DARK ... WAYT GIBBS TGGGATAGCGACGAGCCAGTCTGCTCTAGACAGACGTAGCATATGGGATAGCGACGAGCCAGTCTGCTCTAGACAGT COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC About 20 years ago astronomers became convinced that distant galaxies ... that conversation 68 SCIENTIFIC AMERICAN NOVEMBER 2003 COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC RANDY HARRIS S COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC BRIAN GREENE Q& A SCIENTIFIC AMERICAN: Sometimes...

Ngày tải lên: 12/05/2014, 16:18

87 388 0
scientific american   -  2004 06  -  nanotech and dna

scientific american - 2004 06 - nanotech and dna

... page] Such cages C G T T A G G T A C G C A A T C C A T G d CGTG GCAC CACG GT GC GC TA AT CG CG TA AT AT CG GC C G C A A T C C G C G T T A G G GACTACCG CTGA TGGC GCACGCAT CGTGCGTA T T C A A T G C A ... (top); ALICE Y CHEN (bottom) CACGCAT GTGCGTA X Y X X X X Y Y Y X Y X X Y X X Y Y A TGCGTG TACGCAC CG CG TA AT AT CG GC e Y c CG GC TA TA AT GC GC ATAGC TATCG Y peat distances [see “Photonic Crystals: ... one nuclear ballistic missile could mount a devastating attack on the global satellite system www.sciam.com SCIENTIFIC AMERICAN COPYRIGHT 2004 SCIENTIFIC AMERICAN, INC SCIENTIFIC AMERICAN Volume...

Ngày tải lên: 12/05/2014, 16:20

85 320 0
Grammar for teachers   a guide to american english for native and non native speakers

Grammar for teachers a guide to american english for native and non native speakers

... Teachers Andrea DeCapua Grammar for Teachers A Guide to American English for Native and Non-Native Speakers Author Andrea DeCapua, Ed.D College of New Rochelle New Rochelle, NY 10805 adecapua@cnr.edu ... which variations are used by which groups and in which situations understand which variations are lessacceptable or stigmatized in which situations and why learn which changes are taking place and ... second noun We can say stone fence, wooden fence, iron fence, garden fence and each time describe a different type of fence (See Chapter 3) Mary stopped quickly at the red light Quickly describes...

Ngày tải lên: 26/05/2014, 16:36

461 3,4K 0
w