drug delivery systems for the treatment of periodontal and dental diseases

... treatment for oral cancer As a precondition for the evaluation of the patient groups, the extent of disorder is widespread, as seen by the results of the perceptual assessment and the ASR results The ... in the control group (P < 001) Inter-rater correlations were computed for each of the raters using the respective other raters as reference, that is, the mean of the four other raters for the ... raters for the LE group and the three other raters for the OC group For the comparison between the automatic speech recognition system and the expert ratings, the mean rating of all human raters...

Ngày tải lên: 21/06/2014, 20:20

... treatment for use as drug carriers (A) The schematic illustration of the structure formation of SWCNTs with the two ends closed (B) The schematic illustration of the strategy for the preparation of the ... techniques, and there are great possibilities for them to be used in the construction of drug delivery systems in not too long a time The functionalization of CNTs used in the construction of drug delivery ... This delivery system provided the first instance for nanocarriers to deliver drugs into neurons in the central nervous system, opening the door for the drug delivery system for the treatment of the...

Ngày tải lên: 20/06/2014, 22:20

... contraindication for enrollment in the VNS studies of patients with TRD, there have been no studies of the use of VNS therapy among pregnant patients A report of eight pregnancies in patients receiving VNS therapy ... Inc., collected the data for this pilot study and encouraged the authors to submit this case report to help increase the understanding of VNS therapy and pregnancy References Andersson L, Sundstrom-Poromaa ... DSM-IV diagnosis of unipolar depression, was enrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD At acute-phase study entry, she was noted to be obese and to have...

Ngày tải lên: 08/08/2014, 21:20

... 100% relief of their pain in 86% of the patients with a median relief period of months The range of relief varied from zero days to up to 13 months for the facet injection group None of the lumbar ... median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of the 14 patients ... incapable of re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS...

Ngày tải lên: 26/10/2012, 09:32

... vascular and neural structures increases the risk of adverse events with invasive approaches Open surgical correction is the current standard of care for foraminal stenosis of cervical and lumbar ... average scores of 6.7 and 24.75 on the VAS and Oswestry, respectively and the Individual patient data is presented in Table Utilizing the Student’s t-Test, the data was separated into pre and post ... Pituitaries and kerrisons were then used to remove bulk tissues and bone to open up the spinal canal A standard burr with a 6mm bit was used to remove bone and smooth the bony edges of the opening...

Ngày tải lên: 26/10/2012, 09:57

... laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the ... general, the higher concentration of primers can lead to the formation of primer dimers Also, the cost of the chemicals should be minimized if the same quantitativeness can be achieved The results...

Ngày tải lên: 05/09/2013, 09:38

... (2008ZX07103-001 and 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 08010302109) for the partial support of this study REFERENCES Standard Methods for the Examination of Water and Wastewater ... technical feasibility of this process was demonstrated The effects of recycle ratio, HRT of the regeneration tank, HRT of the adsorption tank and SRT of the system were evaluated The removal efficiency ... with the increased HRT of the adsorption tank From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the...

Ngày tải lên: 05/09/2013, 09:38

... from data in the RCT The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT The data from the monotherapy arm NICE ... guide for healthcare professionals Information for people with metastatic colorectal cancer and their carers (‘Understanding NICE guidance’) Details of all the evidence that was looked at and other ... evidence from the bevacizumab studies and noted that the age of the population in the largest study was lower than the age of patients normally receiving chemotherapy in England and Wales However,...

Ngày tải lên: 14/02/2014, 22:20

... 1967 for the treatment of neoplastic diseases 14 In subsequent years, clinical trials demonstrated the efficacy of this drug for the treatment of CML, psoriasis, and polycythemia vera Although there ... hydroxyurea treatment of hematologic diseases, the toxicity of hydroxyurea in the treatment of any disease, and the barriers to the treatment of sickle cell disease with hydroxyurea or other agents ... HIV/AIDS and/ or hepatitis C More information is needed about the interactions between hydroxyurea and these underlying diseases, and between hydroxyurea and therapies for these diseases Further research...

Ngày tải lên: 05/03/2014, 10:20

... but their development is the result of an aberrant shift in activity of tau kinases and phosphatases [3] Thus, although targeting plaques and NFTs may ameliorate some of the consequences of AD and ... metals within the cell [5,6] The toxic effects of Fe and Cu and their role in numerous neurodegenerative and age-related diseases have been reviewed recently [7] Equally detrimental to the cell is ... function as a counter ion for the high concentrations of glutamate present and quenches the response of the NMDA receptor [36] Like Cu and Fe, considerable data indicates a loss of Zn homeostasis in...

Ngày tải lên: 07/03/2014, 10:20

... against the inclusion of lysine residues in the protein sequence of the A fragment but not the B fragment of PE Because only the A fragment must traffic to the cytosol for activity, the lack of lysine ... engineered into the framework region of the Fv [25–27] A cytotoxic fragment of PE can be inserted at the C-terminus of one of the two Fv polypeptide chains (Fig 1) The generation and production of PE-based ... agent for the elimination of cells have become purposeful strides to generate the immunotoxins of today and, we anticipate, the medicines of tomorrow Advances in our understanding of PE and its...

Ngày tải lên: 22/03/2014, 15:21

... evidence for the optimal period of treatment and number of treatments? We found evidence for the efficacy of shorter treatment protocols than the 4–6 months recommended by the ICS The basis of the ... the differences in outcome The expertise of health professionals may vary and also the quantity and quality of the educational information about the condition and PFM function The impact of these ... and other physical therapies for the treatment of female SUI [13] and UI [1416] has been the subject of previous systematic reviews All of these reviews limited their inclusion criteria to randomized...

Ngày tải lên: 28/03/2014, 14:20

... of Directors of the AUA Funding of the Panel and of the PGC was provided by the AUA, although Panel members received no remuneration for their work Each member of the PGC and of the Panel furnished ... potential of thermal injury to this muscle The thermosensor is introduced through the perineal skin and advanced until the impression of the tip of the thermocouple can be seen in the sphincter The placement ... Cryosurgery for the Treatment of Localized Prostate Cancer The supporting systematic literature review and the drafting of this document were conducted by the Cryosurgery for Treatment of Localized...

Ngày tải lên: 28/03/2014, 23:20

... choice and loading of the NM is a compromise between the required efficiency of the converter and the market price of the NM However, the application of noble metals for the treatment of exhaust ... are formed in adsorption of reactant molecules on the semi-conducting surface; the formation of these is a function of the electronic properties of the solid, and the structure and kind of bonds ... begins with the adsorption of CO and O2 on the Nguyen The Tien 29 Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust...

Ngày tải lên: 12/05/2014, 17:14

... overall survival of treated animals (Figure 6D) These results confirm the anti-tumor activity of anti-VLC therapy, as observed by others, and further support the use of anti-CD52 therapy in humans ... intraperitoneal delivery of the drug Despite being a well-documented therapeutic target, the exact function of CD52 remains unknown In the ID8VEGF tumors, VLC account for the vast majority of tumorassociated ... absence of complement; (1) In the presence of Alemtuzumab and heat inactivated sera, the majority of VLC are viable Annexin V (-) and PI (-) cells In contrast, in the presence of Alemtuzumab and...

Ngày tải lên: 18/06/2014, 15:20

... include the administration of drugs intra-arterially to maximize first-pass drug delivery across the BBTB [44-46], and the temporary opening of the junctions between endothelial cells of the BBTB ... been the use of lipophilic small molecule drugs for increased permeation of drug fraction across endothelial cells of the BBTB[40,41] The effectiveness of this approach has been limited due to drug ... sustained -drug release formulations of small molecule chemotherapy drugs have been developed by the non-covalent attachment of chemotherapy drugs to polymers or the encapsulation of drugs within...

Ngày tải lên: 18/06/2014, 15:20

... manipulandum [33] with their most affected hand The position of the seat was also adjusted in such a way that, with the cursor pointing at the center of the workspace, the elbow and the shoulder joints ... between T0 and T1, and second, between T2 and T3) and treatment (EE or ER) as fixed factors, subject as random factor and the baseline value at the start of the relevant period (i.e., T0 and T2) ... to reduce the observed variation between the two groups of subjects caused not by the treatment itself but by variation of the clinical scale at the beginning of the therapy To test the overall...

Ngày tải lên: 19/06/2014, 08:20

... improve the biomechanical properties of the technique [20] Rowland and Burkhart [21] gave an emphasis on the mathematical need to put the transverse hole for the figure -of- eight tension band wire ... minimal loss of physical capacity The technique remains the "gold standard" for the treatment of displaced and minimally comminuted olecranon fractures despite the introduction of new Page of (page ... 2008, 3:9 Statistics The microsoft excel program was used for the creation of the graphs and the SPSS program 12.0 (SPSS Inc, Chicago, IL, USA) for the creation of statistics Data analysis was...

Ngày tải lên: 20/06/2014, 01:20

... one was for the initial trial of VFG, and the other was for the second trial of VFG after failure of bone consolidation in ipsilateral VFG Patients The mean age of the patients at the time of VFG ... analyzed using the MannWhitney U-test for quantitative data of the term of bone consolidation and leg-length discrepancy, and using Fisher's exact test for qualitative data of the existence of ankle ... results [14], and degenerative changes in the ankle because of the ankle valgus deformity and the intramedullary rod passing through the ankle joint is considered to be the cause of the ankle pain...

Ngày tải lên: 20/06/2014, 01:20

... bending of the hardware, and segmental kyphosis after a caudad screw in the lumbar construct broke And they noted that untreated anterior instability, and pre-stressing of the screws when the rods ... drafting the manuscript and designing of data and revising it critically, KCN has contributed in acquisition of data and analysis and interpretation of data, and JHY has contributed in acquisition and ... through the rod pusher to bring the vertebra back to the rod Gentle distraction at the level of the fracture followed, restoring tension to the posterior longitudinal ligament (ligamentotaxis) and thereby,...

Ngày tải lên: 20/06/2014, 04:20