... Christian Dustmann and Josep Mestres estimate Developing a Road Map for Engaging Diasporas in Development A Handbook for Policymakers and Practitioners in Home and Host Countries that between 1992 and ... The accounts are available for fixed terms of not less than one year and not more than five years The accounts can also be used to obtain loans in India and abroad, both in domestic and foreign ... Development A Handbook for Policymakers and Practitioners in Home and Host Countries 211 CHAPTER 10: CAPITAL MARKET INVESTMENTS Members of the diaspora residing abroad are able to apply for and obtain...
Ngày tải lên: 06/03/2014, 10:20
... receive a fair deal For more information about UDAP laws see National Consumer Law Center, Unfair and Deceptive Acts and Practices (7th ed 2008) For an analysis of the strengths and weaknesses ... discrimination in auto lending and sales, the availability of credit at fair rates, and other matters of importance to consumers and policy makers Auto sales and finance transactions are often ... most auto finance transactions is publicly available would make it less likely that particular data could be tied to an individual transaction B BAN ARBITRATION CLAUSES IN AUTO SALES AND FINANCE...
Ngày tải lên: 30/03/2014, 10:20
báo cáo khoa học: "A consensus linkage map for molecular markers and Quantitative Trait Loci associated with economically important traits in melon (Cucumis melo L.)" pptx
... was integrated into the melon map that, together with the mapped candidate genes, may provide a suitable framework for QTL/candidate gene analysis In summary, the integrated map will be a valuable ... merged map, AD assisted in the map merging, prepared tables, and graphic representations and helped to draft the manuscript PZ and JB formatted the data for representation with C-maps for publication ... contigs available at ICuGI web page and mapped by the NERCV group Four SNPs (AF- and AB- markers) were released by NIVTS (National Institute of Vegetable and Tea Science, Mie, Japan) group and mapped...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc
... B3 Ap32# Ar10 Figure A linkage map for the B-genome of Arachis A linkage map for the B-genome of Arachis Linkage map of Arachis based on an F2 population resultant from the cross A ipaënsis × A ... development and analysis, and participated in drafting the manuscript Additional material Additional File Data of crossings between A ipaënsis (accession K30076) and A magna (K30097) The data provides ... CL, Garcia AAF, Garcia AF, Silva AR, Mangolin CA, Benchimol LL, De Souza AP: Molecular mapping in tropical maize (Zea mays L.) using microsatellite markers Map construction and localization of...
Ngày tải lên: 12/08/2014, 03:20
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt
... information are advised and encouraged to confirm specific claims for product performance as necessary and appropriate The legal/financial materials and information that are available for reference ... InfraGard chapter John W Rado is a geospatial analyst at National Imagery and Mapping Agency (NIMA) in St Louis, Missouri John has worked for NIMA since January of 1991 William J Sampias has been ... legal/financial counsel as may be appropriate for any matters to which the legal/financial materials and information may pertain Web sites included in this manual are intended to provide current and accurate...
Ngày tải lên: 18/01/2014, 06:20
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratasereactivating factor in ADP-bound and nucleotide-free forms ... respectively, and the a and b subunits of the reactivase are abbreviated as aR and bR, respectively, molar ratios of aD, bD, cD, aR and bR in bands i and vi were determined to be about : : : : and : : : ... Bando R, Hieda N & Toraya T (2004) Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonia lyase J Bacteriol 186, 6845–6854 Baker JJ & Stadiman TC (1982) Amino...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx
... tubular apparatus with sharp curves, and for coating newly-made glass apparatus with a layer of soot to prevent too rapid cooling, and its usually associated result—cracking Fig 12.—Glass blower's ... MICROSCOPICAL EXAMINATION OF BACTERIA AND OTHER MICRO-FUNGI 69 Apparatus and Reagents used in Ordinary Microscopical Examination, 69—Methods of Examination, 74 VI STAINING METHODS 90 Bacteria Stains, ... only at supplementing the usually scanty details of technique, and at instructing the student how to fit up and adapt apparatus for his daily work, and how to carry out thoroughly and systematically...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc
... reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available For each utterance in the input, the parser needs to find an interpretation that starts ... utterances, with no systematic allowance for speech repairs and editing terms Such a treatment cannot adequately deal with dialogs involving more than one human (as appear in machine translation ... over that term to allow utterances to be formed around it This metarule (and our other metarules) can be viewed declaratively as specifying allowable patterns of phrase breakage and interleaving...
Ngày tải lên: 20/02/2014, 19:20
A New Vision for Adolescent Sexual and Reproductive Health pot
... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... more effective methods than are their American peers As noted, they are less likely to be poor and they have greater access to sexual and reproductive health care services Dutch policy makers and...
Ngày tải lên: 05/03/2014, 17:20
The ‘global health’ education framework: a conceptual guide for monitoring, evaluation and practice doc
... health All authors have read and approved the final manuscript Authors’ information KB (Doctoral candidate) studied medicine in Frankfurt (Germany) and Bangalore (India), undergoing a research ... [11,18] as well as Canada [19] and the United States of America [20] have realised the importance of teaching undergraduate medical students about international or global health issues and this teaching ... determinants Towards ‘health for all’ **/+ Learning opportunities in ‘global health’ should adopt and impart the ethical and practical aspects of achieving ‘health for all’ To ensure that educational...
Ngày tải lên: 05/03/2014, 22:21
SEXUAL ORIENTATION AND SCHOOL POLICY A Practical Guide for Teachers, Administrators, and Community Activists potx
... who helped raise me and helped make me the person I am today Many thanks to my grandparents, Ian Callum and Marjorie Aitkens Macgillivray and Kenneth Henry and Dorothy Grefe Ruf Thanks also to my ... the Creator And I believe the moral absolutes that his word presents [He quotes a passage from the Bible here and continues.] God created Adam and Eve and not Adam and Steve God ordains and supports ... Available Library of Congress Cataloging-in-Publication Data Macgillivray, Ian K 1967Sexual orientation and school policy : a practical guide for teachers, administrators, and community activists...
Ngày tải lên: 15/03/2014, 05:20
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc
... metrics and levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis and Diagnosis Human analysis is crucial ... e ı a Measures for Automatic Machine Translation Evaluation Machine Translation, 24(3–4):77–86 Ahmed El Kholy and Nizar Habash 2011 Automatic Error Analysis for Morphologically Rich Languages ... Error Analysis and Proposed Solutions for the Catalan—Spanish Language Pair LREC, 45(2):181–208 Mark Fishel, Ondˇej Bojar, Daniel Zeman, and Jan Berka r 2011 Automatic Translation Error Analysis...
Ngày tải lên: 16/03/2014, 20:20
Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc
... lexical database Kristina Toutanova and Mark Johnson 2008 A bayesian LDA-based model for semi-supervised part-of-speech tagging In nips08 Antal Van Den Bosch and Walter Daelemans 1999 Memory-based ... Erwin Marsi Antal van den Bosch and Abdelhadi Soudi 2007 Memory-based morphological analysis and partof-speech tagging of arabic In Abdelhadi Soudi, Antal van den Bosch, and Gunter Neumann, editors, ... a latent tag-set variable is used as a basis for prediction: the relative error reduction in Lem F-measure is 21.7% for English and 25% for Bulgarian For Bulgarian and the other Slavic languages...
Ngày tải lên: 17/03/2014, 01:20
Guidance on Cancer Services Improving Supportive and Palliative Care for Adults with Cancer ppt
... needs for palliative care, of each patient and carer at all stages of the patient pathway and in all domains of care understand how to enable patients and carers to use their own knowledge and ... incorporated into the Manual of Cancer Services Standards31 in England (and the all-Wales minimum standards for specialist palliative care1 8 ), and the quality of supportive and palliative care services ... for palliative care services in Wales17 • the All-Wales Minimum Standards for specialist palliative care1 8B • a Cancer Information Framework and the establishment of a Cancer Information Framework...
Ngày tải lên: 28/03/2014, 23:20
interference calculus a general framework for interference management and network utility optimization
... convex analysis and linear algebra A general willingness to carry out detailed mathematical analysis is, however, important The proofs and detailed calculations should help the reader in penetrating ... denition, for any >0 γ ∈ ∂S (2.41) is achievable, at least in an asymptotic sense That is, there exists a p >0 such that SIRk (p ) ≥ γk − for all k ∈ K A general characterization of achievability can ... = x means that inequality holds for at least one component • exp(y) and log(y) means component-wise exponential and logarithm, respectively Some often used variables and quantities are as follows...
Ngày tải lên: 29/05/2014, 16:52
the mit press processing a programming handbook for visual designers and artists sep 2007
... utensils and papers For quick sketching, newsprint and charcoal are appropriate For a refined drawing, a smooth handmade paper and range of pencils may be preferred In contrast, when you are drawing ... personal desire for escape or transformation Leon Hong created an elegant flying simulation in which the player floats above a body of water and moves toward a distant island Muskan Srivastava wrote ... software examples Each student maintains a web page containing all of their software and source code created for the class These pages provide a straightforward way to review performance and make...
Ngày tải lên: 11/06/2014, 16:34
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx
... Statistical Analyses Part One Functional Movement Screen Data was coded using Stata 8.0 For exploratory data analysis we used bivariate methods The primary hypothesis was assessed with multivariate analysis ... fire department database, and other selected parameters (age, gender, tenure and rank) http://www.occup-med.com/content/2/1/3 icine physician, therapist, and fire department health and safety officer) ... activities and were on a full duty status Age at time of the study ranged from 21 to 60 years with a mean of 41.8 years for males and 37.4 years for females The subjects were 408 male (94.2 percent) and...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
... settings[25-27] and may be associated with favorable clinical and virologic outcomes in patients with both TB and HIV disease in need of treatA Common TB and HIV Paradigm An Alternative TB and HIV Paradigm ... 196:S63-S75 Abstract Gasana M, Vandebriel G, Kabanda G, et al.: Tuberculosis in Rwanda: challenges to reaching the targets Bull WHO 2007, 85:383-384 International epidemiologic databases to evaluate AIDS: ... services at both national and local levels New Ways of Delivering Integrated Care With Nontraditional Healthcare Providers A critically important issue to both TB and HIV programs is the availability...
Ngày tải lên: 20/06/2014, 08:20