draw a basic block diagram of dcs

Tài liệu USA INC. A BASIC SUMMARY OF AMERICA''''S FINANCIAL STATEMENTS pdf

Tài liệu USA INC. A BASIC SUMMARY OF AMERICA''''S FINANCIAL STATEMENTS pdf

... (such as Social Security and Medicare), data per Treasury Dept.'s “2010 Annual Report on the U.S. Government”; 3) Gordon Adams and Matthew Leatherman, A Leaner and Meaner National Defense,” ... debate about our nation’s financial situation and outlook. In it, we examine USA Inc.’s income statement and balance sheet. We aim to interpret the underlying data and facts and illustrate patterns ... corporate and official government accounting methods, see Laurence J. Kotlikoff, Alan J. Auerbach, and Jagadeesh Gokhale, “Generational Accounting: A Meaningful Way to Assess Generational Policy,” published...

Ngày tải lên: 17/02/2014, 21:20

266 1.8K 0
Tài liệu THE BUFFETT RULE: A BASIC PRINCIPLE OF TAX FAIRNESS docx

Tài liệu THE BUFFETT RULE: A BASIC PRINCIPLE OF TAX FAIRNESS docx

... Some of the wealthiest Americans can hire lawyers and accountants to take advantage of tax expenditures and loopholes that enable them to pay a lower share of their income in taxes than average ... High-Income Americans Are Paying Less As a Share of Their Income Than Middle Class Americans Because some of the richest Americans pay taxes at such extraordinarily low rates, they end up paying ... well-off can take advantage of tax expenditures and preferential rates on certain income. In a time when all Americans are being asked to come together to make the sort of shared sacrifices that...

Ngày tải lên: 20/02/2014, 19:20

8 385 0
A Knowledgeable Model: Network of C-Objects

A Knowledgeable Model: Network of C-Objects

... O. Put A 0 = A, A 1 = t 1 (A 0 ), . . ., A m = t m (A m-1 ), and D (A) = A m , we have A 0 ⊆ A 1 ⊆ . . . ⊆ A m = D (A) ⊆ M. A problem A → B on a network (O,F) is called solvable if and only ... B i-1 . 4 Application Example Now we state an application example: solve a geometry problem. This example is solved by a program written in the programming language C++. The program gave us a good ... the above figure 2, suppose that AB = AC, the values of the angle A and the edge BC are given. ABDE and ACFG are squares. Compute EG. The problem can be considered on the network of C-objects as...

Ngày tải lên: 18/09/2012, 10:13

8 366 2
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"

Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"

... Kongstad P, Kurola J, Nakstad AR, Sandberg M: Pre- hospital airway management: guidelines from a task force from the Scandinavian Society for Anaesthesiology and Intensive Care Medicine. Acta Anaesthesiol ... have come to our attention. Targets of action and problems that may need to be resolved are listed below. ã A national, standardized medical operative ambu- lance manual is needed ã A national, ... WF, Baskett PJ: Recommendations for uniform reporting of data following major trauma–the Utstein style. A report of a working party of the International Trauma Anaesthesia and Critical Care Society...

Ngày tải lên: 25/10/2012, 09:56

11 706 1
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

... (MedCalc Software, Mariakerke, Bel- gium). statistical software was used for all statistical anal- yses. Categorical data are presented as absolute and relative frequencies, continuous variables as ... Diabet Med 2006, 23:1370-1376. 34. Ishihara M, Inoue I, Kawagoe T, Shimatani Y, Kurisu S, Hata T, Nakama Y, Kijima Y, Kagawa E: Is admission hyperglycaemia in non-diabetic patients with acute ... Ako J, Kadowaki T, Funayama H, Sugawara Y, Kubo N, Momomura S: Impact of acute hyperglycemia during primary stent implantation in patients with ST-elevation myocardial infarction. J Cardiol...

Ngày tải lên: 25/10/2012, 10:02

8 657 1
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"

Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"

... James F Gardner 1 , Gerd Glaeske 5 and Satish C Valluri 1 Address: 1 Pharmaceutical Health Services Research, School of Pharmacy, University of Maryland, Baltimore, Maryland, USA, 2 Department ... provided data and participated in the design and analysis of the study. JFG and SCV pro- vided computerized data management and statistical analysis. JMZ and DJS drafted the manuscript. JMF and LTWJ ... methylphenidate and amphetamine products. Anticonvulsant-mood stabilizers (ATC-MS) included carbamazepine, divalproex/valproic acid, lamo- trigine, gabapentin and topiramate. Cross-national com- parisons...

Ngày tải lên: 25/10/2012, 10:06

8 489 1
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation and drafting the manuscript. Acknowledgements To the Medical Statistics ... did not affect the patient but, in these cases, nurses administered medication without a legally valid physi- cian order. Although an absent 'signature' with CPOE was regarded as an error, ... full audit trail, legibility, use of approved names, specification of key data fields such as route of admin- istration, storage and recall of records. Although the CPOE system recently installed...

Ngày tải lên: 25/10/2012, 10:39

6 526 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

... Kaats GR was the principal investigator; he se- cured and audited all study data, conducted all of the statistical analyses, and contributed significantly to the preparation and submission of ... investigators‟ DXA (Total Body Du- al-energy X-ray Absorptiometry) database, from par- ticipants at a local health fair, and from referrals from subjects who agreed to participate. All subjects ... known as „AlgaeCal‟ or „AC‟) made by milling whole, live-harvested sea algae found on the South American coastline. In addition to calcium, the algae contained other naturally occurring minerals...

Ngày tải lên: 25/10/2012, 11:10

12 664 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

... Fatema Hasan Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, 431003  Correspondence to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, CTS No. 3910, Near Bombay Mercantile ... 3910, Near Bombay Mercantile Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email: hunaidhasan@hotmail.com or zainabhasan52@hotmail.com. Phone: +91-240-234-8673/ ... of 730 participants between the ages of eighteen and thirty-nine years. 366 participants were from Aurangabad, India (AUR), and 364 participants were from Mississauga, Canada (MISS). The participants...

Ngày tải lên: 26/10/2012, 09:57

12 758 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... polymerase chain reaction. Med Sci Monit. 2001; 7: 345-9. 14. Ogawa Y, Itoh H, Nakagawa O, et al. Characterization of the 5'-flanking region and chromosomal assignment of the human brain natriuretic ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A) . The PCR ... declared that no conflict of in- terest exists. References 1. Kangawa K, Matsuo H. Purification and complete amino acid sequence of alpha-human atrial natriuretic polypeptide (al- pha-hANP)....

Ngày tải lên: 26/10/2012, 10:04

7 612 1
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... towards recognising the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1]. A strong reason ... desirable control strategy. The analysis of fractal patterns in gait and posture data may serve as an indicator of pathology or impairment. Surrogate data analysis is used to test for a system’s ... examine appropriate data using such techniques. In particular, a non-linear approach to the analysis of COP data may be appropriate and may reveal information regarding a person’s control of their...

Ngày tải lên: 03/11/2012, 10:09

10 458 0
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

... river basin management and/or ecosystem-based river basin management (Nakamura, 2003). Embedded in these approaches are the concepts of participatory management and adaptive management (Miser and ... efficiency of our actions. 1.2.3. Integrated management and policy analysis Integrated management Rapid changes of objectives and methodological approaches towards the management of natural resources ... by means of the Morris analysis, as in this chapter. Examples of the decision variables in RaMCo are the number of fish blasts, the total capacity of urban wastewater treatment plants, and the...

Ngày tải lên: 06/11/2012, 10:35

139 492 0
w