dose dose interval and plasma level fluctuation a
Báo cáo y học: " Treatment outcomes and plasma level of ritonavir-boosted lopinavir monotherapy among HIV-infected patients who had NRTI and NNRTI failure" docx
... Materials and methods All patients followed at Bamrasnaradura Infectious Diseases Institute, Ministry of Public Health, Thailand, Table summarizes subject characteristics and laboratory parameters ... Netherlands-Australia-Thailand Clinical Research Laboratory, which is located at the Chulalongkorn Medical Research Center (Bangkok), by high-performance liquid chromatography This assay was performed ... involved antiretroviral-naïve patients by Delfraissy and colleagues [10] Of 84 patients in ritonavir-boosted lopinavir monotherapy arm, 67% and 79% had achieved undetectable plasma HIV-1 RNA by intend-to-treat...
- 5
- 302
- 0
Báo cáo y học: "Alternative way to test the efficacy of swine FMD vaccines: measurement of pigs median infected dose (PID50) and regulation of live virus challenge dose" docx
... References Balamurugan V, Kumar RM, Suryanarayana VV: Past and present vaccine development strategies for the control of foot-andmouth disease Acta Virol 2004, 48(4):201-14 Grubman MJ, Baxt B: Foot -and- mouth ... of antibodies against foot -and- mouth disease virus Journal of Immunological Methods 1986, 93:123-129 15 Van Maanen C, Terpstra C: Comparison of a liquid-phase blocking sandwich ELISA and a serum ... inactivated vaccine respectively, and three pigs were bred without vaccination in the same room as negative control Sera samples were collected at 14 dpv (days post vaccination) and 28 dpv to assay...
- 3
- 306
- 0
Báo cáo y học: " Overcoming beta-agonist tolerance: high dose salbutamol and ipratropium bromide. Two randomised controlled trials" pps
... thank the study participants We also thank Dr J McLachlan and the staff of the Waikato Hospital Respiratory Laboratory, Dr Graham Mills and the Waikato Respiratory Research Unit and Jan Cowan ... [24] Salmeterol is a partial agonist at the beta-receptor compared to formoterol and theoretically it may be less likely to induce tolerance Alternatively, salmeterol could act as a partial antagonist ... linear interpolation of the last two doses Immediately after the challenge, 200 µg salbutamol or 40 µg ipratropium was given via a metered dose inhaler and large volume spacer FEV1 was measured...
- 7
- 181
- 0
Tài liệu Central Office Line Buildout Settings and Equal Level Point docx
... for all network elements to a standard equal level point at the DSX, service providers are able to cross-connect any two network elements at any point in time and achieve an operational transmission ... settings are used to modify transmission power levels to achieve a desired level at the receiver without consideration of equal level point at the DSX, network standards are compromised DSX and equal ... carrier cables to the demarcation point If equal level point standards are not designed into the circuit when the carrier cabling is assigned, custom engineering efforts and service delays can occur...
- 2
- 321
- 0
Tài liệu STRATEGY FOR THE MANAGEMENT AND DISPOSAL OF USED NUCLEAR FUEL AND HIGH-LEVEL RADIOACTIVE WASTE ppt
... Management and Disposal of Used Nuclear Fuel and High -Level Radioactive Waste INTRODUCTION AND SUMMARY The Strategy for the Management and Disposal of Used Nuclear Fuel and High -Level Radioactive ... the Administration and Congress can build a national program for the management and disposal of the nation’s used nuclear fuel and high -level radioactive waste The BRC report and the Strategy ... storage facility within the next 10 years and later Strategy for the Management and Disposal of Used Nuclear Fuel and High -Level Radioactive Waste at a larger consolidated interim storage facility...
- 18
- 584
- 1
Báo cáo khoa học: Sensitivity to Hsp90-targeting drugs can arise with mutation to the Hsp90 chaperone, cochaperones and plasma membrane ATP binding cassette transporters of yeast docx
... rabbit polyclonal antisera raised against the bacterially expressed Hsp82 and Sba1p of yeast Hsp90 ATPase assays Hsp90 ATPase assays used a regeneration coupled enzyme assay [24], each mL of assay ... bactopeptone, 1% yeast extract, 20 mgÆL)1 adenine) GA was a gift from the National Cancer Institute (Bethesda, MD, USA) RD was purchased from Sigma Assays of HSF induction Heat shock factor activity ... d Relative to YPH500 parent (see Fig 4B) Materials and methods Strains and growth media The Saccharomyces cerevisiae strains used for this study are listed in Table Deletion of the SBA1 and STI1...
- 7
- 397
- 2
Hệ Quản Trị Cơ Sở Dữ Liệu - Locks and Isolation level pdf
... tran set tran isolation level REPEATABLE READ select TEN from DocGia where ma_docgia = waitfor delay‘00:00:05’ begin tran update DocGia set TEN= ’xxx’ where ma_docgia =1 select TEN from DocGia ... tran set tran isolation level REPEATABLE READ select TEN from DocGia where ma_docgia > 90 waitfor delay‘00:00:05’ begin tran INSERT into DocGia VALUES (111,'Tuyết',…) select TEN from DocGia where ... hợp 2b T1 T2 begin tran set tran begin tran isolation level SERIALIZABLE select TEN from DocGia where ma_docgia >90 waitfor delay‘00:00:05’ begin tran INSERT into DocGia VALUES (111, 'Tuyết',…)...
- 16
- 1,369
- 23
Báo cáo khoa học: "Sentence and Expression Level Annotation of Opinions in User-Generated Discourse" potx
... a very average GPA and only 20; I already make above $45,000 a year as a programmer with a large health care company for over a year and have had promotions up in the first year and a half Such ... other hand, we obtain moderate agreement levels for the opinionated and polar fact attributes 62% of the topic relevant sentences were labeled as opinionated by at least one annotator, and the ... span For instance, upon marking a text span as a polar target or an opinionexpression, one has to label the polarity and strength We consider the overlapping spans for each annotation type and...
- 10
- 432
- 0
GCE AS and A Level Specification English Literature B pot
... To be awarded an A* , candidates will need to achieve a grade A on the full A Level qualification and an A* on the aggregate of the A2 units For AS and A Level, candidates who fail to reach the ... AS exams 2009 onwards and A2 exams 2010 onwards (version 1.4) Band (16 – 20 marks) AO1 AO1 AO2 AO2 AO3 AO3 AO4 AO4 use of accurate critical vocabulary and clear argument expressed accurately ... Assessment Units and Certification Examinations and certification for this specification are available as follows: Availability of units AS Availability of certification A2 AS A Level January 2009 June...
- 33
- 680
- 1
Báo cáo khoa học: Modulation of Ca2+ entry and plasma membrane potential by human TRPM4b pptx
... 5¢-GTCGACCTGGGCTGCAGGAGGTTG-3¢ and 5¢-GT ACCTCGCAGGGAACGAG-3¢; segment 2, 5¢-AGCCT GGATTGTCACTGG-3¢ and 5¢-GGGCTCCTCTTCTGA TTTCC-3¢; and segment 3, 5¢-GACCCTGGAAGACAC TCTGG-3¢ and 5¢-AGGAATCTGTGAGTGGTGAGG-3¢) ... T-easy (Promega, Munich, Germany), and sequenced Integration of exon 17 was achieved by fusion PCR [19] (mega-primers: 5¢-TCATTAATGGGGAAGGGCCTGTCG GGACGGCGGACCCAGCCGAGAAGA-3¢ and 5¢-AGG TGGTACAAACCCGGGGTCAGCCGGCAGCCCACGCC ... (forward primer, 5¢-AGGCAATTGTGCAGGCGACC-3¢, and reverse primer, 5¢-TTATGTTTCAGGTTCAGGGG-3¢) As a negative control, reverse transcriptase was inactivated by heat Products were separated on 1% agarose...
- 10
- 407
- 0
Báo cáo khoa học: Increased glucose metabolism and ATP level in brain tissue of Huntington’s disease transgenic mice pdf
... Km (GAP) for GAPDH and aldolase, and increased Vmax for HK (Table 5, model 6b) at mM ATP concentration (white columns) and at mM ATP concentration (black columns) The simulation was also carried ... http://jjj.biochem.sun.ac.za/database/olah2cc/index html; http://jjj.biochem.sun.ac.za/database/olah2cb/index html; http://jjj.biochem.sun.ac.za/database/olah2hdc/ index.html; http://jjj.biochem.sun.ac.za/database/olah2hdb/ ... significant alterations in N-acetylaspartate, glutamine, glutamate and glucose levels and suggested that the development of the disease could be related to a fundamental perturbation of the metabolic...
- 16
- 454
- 0
Báo cáo khoa học: "Combining Word-Level and Character-Level Models for Machine Translation Between Closely-Related Languages" ppt
... and we further appended special start and end characters We split the resulting list into training, development and testing parts and we trained and tuned a character -level MacedonianBulgarian ... lattice using a Bulgarian language model; this increased BLEU to 22.74 Word -level translation Naturally, lattice-based transliteration cannot really compete against standard word -level translation (w1), ... Tiedemann 2012 Character-based pivot translao tion for under-resourced languages and domains In Proceedings of EACL ’12, pages 141–151, Avignon, France Masao Utiyama and Hitoshi Isahara 2007 A comparison...
- 5
- 357
- 0
Addressing Chronic Disease through Community Health Workers: A POLICY AND SYSTEMS-LEVEL APPROACH doc
... education and disease and case management (for heart disease and stroke, diabetes, prenatal care, immunizations, breast and cervical cancer, diabetes, and asthma) but also the promotion of change ... health insurance; enrollment and referral to appropriate health care agencies; and mater nal health and prenatal care Division for Diabetes Translation (DDT) A number of state and territorial ... burden of diabetes is disproportionately borne by American Indians and Alaska Natives, African Americans, Hispanic or Latino Americans, and Asians/Pacific Islanders The devel opment of diabetes is...
- 20
- 260
- 0
báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot
... T12 L1 L1 T11 T11 T11 L1 L1 T12 MVA MVA MVA MVA MVA MVA MVA MVA MVA Fall Fall MVA Fall MVA MVA Fall MVA MVA Fall MVA MVA Fall MVA MVA Fall MVA Fall Fall MVA MVA MVA FD UB UB UB UB UB UB UB UB TRS ... final approval, HKK has contributed in drafting the manuscript and designing of data and revising it critically, KCN has contributed in acquisition of data and analysis and interpretation of data, ... radiogram showed at final extension (3 years) a) AP and lumbar motionc) flexion at final follow-up (3 years) a) AP and b) lateral radiogram showed maintenance of correction in kyphosis, and c)...
- 6
- 519
- 1
Báo cáo hóa học: " Improved characteristics of near-band-edge and deep-level emissions from ZnO nanorod arrays by atomic-layer-deposited Al2O3 and ZnO shell layers" potx
... et al Nanoscale Research Letters 2011, 6:556 http://www.nanoscalereslett.com/content/6/1/556 Page of A B Figure Band diagrams Schematic band diagrams of (a) as-grown ZnO NRAs and (b) ZnO/Al2O3 ... region can be regarded as an upward band bending toward the surface as presented in the band diagram shown in Figure 3a When the ZnO NRAs are irradiated by the pumping laser beam, the photo-generated ... NRAs The nearband-edge (NBE) emission was significantly enhanced, and the deep -level band was suppressed by the Al2O3 and ZnO shells due to the flat-band effect and the reduction in the surface...
- 9
- 308
- 0
Báo cáo hóa học: " Research Article Phoneme and Sentence-Level Ensembles for Speech Recognition" pot
... where each class y ∈ Y corresponds to a phoneme As long as the available data are annotated so that subsequences containing single phoneme data can be extracted, it is natural to adapt each hidden ... instantaneous distributions Zweig and Padmanabhan [19] appear to be using a similar technique, based on Gaussian mixtures The authors additionally describe a few boosting variants for large-scale ... a single HMM and then examine whether bagging or boosting can improve the classification or speech recognition performance In all cases, the diagonal covariance matrix elements of each Gaussian...
- 17
- 400
- 0
Mobile and wireless communications network layer and circuit level design Part 1 potx
... microstrip antennas, broad band and UWB antennas, reconfigurable microstrip antennas and smart microstrip antennas Their advantages, disadvantages, design technique, structure and application have been ... communication Applications 219 Fayrouz Haddad, Lakhdar Zaïd, Wenceslass Rahajandraibe and Oussama Frioui 12 Fully Integrated CMOS Low-Gain-Wide-Range 2.4 GHz Phase Locked Loop for LR-WPAN Applications ... Networks 037 Samitha Ekanayake and Pubudu Pathirana Smart wireless communication platform IQRF 061 Radek Kuchta, Radimir Vrba and Vladislav Sulc Wireless in Future Automotive Applications 071 Volker...
- 30
- 326
- 0
Mobile and wireless communications network layer and circuit level design Part 2 potx
... Foschini and Miljanic (Foschini and Miljanic 1993) has become a standard benchmark due to its academic and practical significance (see (Cai, Wang et al 2004; Uykan and Koivo 2004; Uykan and Koivo ... proposed by Yang and Wang can be classified as: all-to-all broadcasting and all-to-all personalized exchange depending on the nature of the communication (Yang and Wang 2001) In the former case, the ... primarily focused on the military and navigation applications (Batchelor, Ochieng et al., 1996) As the first civilian application, a narrow-band spread spectrum CDMA scheme for cellular communication...
- 30
- 447
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25