... satisfactory quality TAKE CHARGE OF YOUR VISIT TO A GARAGE MAKING COMPLAINTS If you have a complaint, raise it with the garage as soon as possible It’s only fair that they have a chance to deal with ... correct and that it has been correctly stamped The service record book has been stamped with the garage’s stamp and that the relevant details of the service are correct Rather than replacing parts ... AA www.theaa.com Trading Standards Trading Standards services are provided by your local authority For contact details of your local department see your phone book or go to: www.tradingstandards.gov.uk...
Ngày tải lên: 30/03/2014, 10:20
... is their IT department So with those caveats in mind here are ten ideas about the tools that are worth keeping in mind as you begin to introduce them Have a variety of tools rather than a single ... challenges apart and writing them down helps to place them at a distance that allows you to see them for what they are If we have the courage to this in a way that is 31 Organizations Don t Tweet, ... after action reviews more often than not pass on what you want others to see rather than all the messy, gutsy stuff that it really took to make the project happen 22 Leaving a Trace In contrast to...
Ngày tải lên: 15/03/2014, 15:20
Don’t Be Taken for a Ride Guide to Auto Leasing pdf
... as service contracts, alarms and undercoating the car Balloon-Note Financing A form of auto financing that is similar to a lease that has gained in popularity is called “balloon-note” financing ... should also realize that you have a right to receive important information that is accurate, including the material terms and conditions that will be a part of your lease, without having to endure ... and that of the representative accepting the car, the mileage clearly stated, and a detailed review of the condition of the car at the time that you turn it in If you not get this receipt, it...
Ngày tải lên: 16/03/2014, 12:20
SCAFFOLDING AN EFL (ENGLISH AS A FOREIGN LANGUAGE) ''''EFFECTIVE WRITING'''' CLASS IN A HYBRID LEARNING COMMUNITY pot
... tried to be neutral in the data analysis by aggregating or triangulating the data from different sources and as a result, drawing the theories can be established from the data aggregation or triangulation ... Stats–www.internetworldstats.com/stats3.htm Copyright © 2009, Miniwatts Marketing Group Figure 1.3 Asia top ten Internet countries The data presented in Figures 1.2 and 1.3 also indicate that ... factor was related to the infrastructure used to mediate the content delivery In its initial stages, the university installed many relay transmitters throughout the campus, to strengthen the...
Ngày tải lên: 19/03/2014, 07:20
CHILD HEALTH CARE DEMAND IN A DEVELOPING COUNTRY: UNCONDITIONAL ESTIMATES FROM THE PHILIPPINES doc
... appear once, some more than once, and some not at all At each pass (called a replication), the estimator is applied to the data and the resulting parameter estimates are saved as a data set Using ... Although the average of the bootstrapped statistic is used in the calculation of the standard deviation, it is not used as the estimated value of the statistic itself; the point estimate is the original ... quality data in their analysis 6 understanding of the factors affecting utilization of basic health services for young children deserves greater attention The results indicate that health care...
Ngày tải lên: 28/03/2014, 09:20
I don’t know who or what he is; and I don’t care. (Tôi chẳng biết ông ta là ai hay ông docx
... Câu vi t tiếng Anh sau: I want you not to forget that Unit 20 Date and time (Ngày tháng thời gian) Date Date ngày tháng, nh t kỳ Các thứ tuần tiếng Anh vi t: Monday :Thứ Hai Tuesday :Thứ Ba Wednesday ... :felt to know :knew to let :let to lend :lent to hear :heard to hold :held to meet :met to stand :stood to mean :meant to read /rid/ :read /red/ to sit :sat to take :took to think :thought * Chúng ... Wednesday :Thứ T Thursday :Thứ Năm Friday :Thứ Sáu Saturday :Thứ Bảy Sunday :Chủ Nh t Người ta thường vi t t t cách vi t ba chữ t Ví dụ: Mon = Monday, Tue = Tuesday,… Các tháng bao gồm: January :Tháng...
Ngày tải lên: 19/06/2014, 18:20
báo cáo hóa học: " Prevalence of latent tuberculosis infection among health care workers in a hospital for pulmonary diseases" pptx
... contributions to interpretation of data She has been involved in revising the manuscript critically for important intellectual content AN has made substantial contributions to conception and ... design, as well as to analysis and interpretation of data He has been involved in drafting the manuscript AS has made substantial contributions to conception and design, acquisition of data, as well ... suggests that these Interferon-γ release assays have higher specificity and at least equal sensitivity as the TST and are unaffected by previous BCG vaccination and most NTM Therefore this test reduces...
Ngày tải lên: 20/06/2014, 00:20
Don''''t Make Me Think: A Common Sense Approach to Web Usability doc
... find in the first place and visitors may not know of an alternative The prospect of starting over isn t always that attractive And there’s also the “I’ve waited ten minutes for this bus already, ... in a store: it just makes everything seem better Using a site that doesn t make us think about unimportant things feels effortless, whereas puzzling over things that don t matter to us tends to ... in it Trademarks Throughout this book, trademarks are used Rather than put a trademark symbol in every occurrence of a trademarked name, we state that we are using the names in an editorial fashion...
Ngày tải lên: 27/06/2014, 00:20
Báo cáo y học: "The relationship between predicted peptide–MHC β class II affinity and T-cell activation in a HLA-DRβ1*0401 transgenic mouse model" pptx
... vaccination with the recombinant hepatitis B surface antigen (HBsAg) [18–20], and we have also shown that many of these patients express MHC containing the shared epitope These observations have ... anchoring positions may Available online http://arthritis-research.com/content/5/1/R40 induce subtle changes in the MHC molecule at regions that are critical for TCR interaction It has recently ... addition to the altered MHC contact surface, it has been shown that a conserved substitution of the peptide side-chain interacting with P6 can essentially abrogate T- cell recognition [43] The substitution...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx
... incubated with a directly streptavidin-alkaline phosphatase (ALP) conjugated biotinylated detection antibody clone 7-B6-1 (Mabtech), washed again and a ready-to-use BCIP/NBT-plus substrate solution ... CA) The significance level was 0.05 for all statistical tests http://www.aidsrestherapy.com/content/5/1/22 Additional material Additional file Gating strategy Representative example showing the ... rendering this new modality of evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions of standards ... TB[13,14] Thymic atrophy characterises diet induced malnutrition in mice;[15] and the administration of the satiety hormone, leptin which acts via the nutritional-status-sensitive[16] hypothalamic-pituitaryadrenal ... manuscript PTN did the laboratory work including all the molecular analyses JS participated in the field work; GM and SEM participated in drafting the manuscript All authors read and approved the final...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
... 5’-TCAGACCCTGAGGCTCAAAGTC-3’ CML (upstream) 5’-CGCATGTTCCGGGACAAAAGC-3’ Results Genetic feature of the CML case Clinical, cytogenetic and molecular features of different disease stage in this patient ... may induce different response of TCR repertoire pattern It would be interesting to detect the evolution of T- cell clonality in the patient at different disease status The features of restrictive ... developed Ph-negative acute lymphoblastic leukemia following imatinib therapy for months It was thought that the Ph-negative leukemic cells might originate from a new malignant clone rather than previous...
Ngày tải lên: 10/08/2014, 22:21
báo cáo khoa học: " Potential chromosomal introgression barriers revealed by linkage analysis in a hybrid of Pinus massoniana and P. hwangshanensis" ppsx
... displays a relatively low germination rate In that sampling area, pines dominate the landscape above 600 m Below this elevation, pines mix with abundant broad-leave trees, which will affect the pine ... undergoes megagametogenesis to give rise to the megagametophyte and to produce the female gamete Thus, the megagametophyte is haploid tissue and has the same DNA as the female gamete that is fertilized ... pollination We propose the drop in this value might be mainly due to environmental factors In Table 1, the tree at 795 m in Wuyi Mountain possesses the lowest seed germination rate in the tested...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt
... name IW9 mutation TSTLQEQIGW (TSTLQEQIGW) TSTLAEQVAW ( A VA-) TSTLAEQIAW ( A -A- ) TSTLSEQVAW ( S VA-) TSTLSEQIAW ( S -A- ) TSTLTEQVAW ( T VA-) TSTLTEQIAW ( T -A- ) TSTLVEQIAW ( V -A- ) TSNLQEQIGW ... alternate mutations in this epitope may be revealing The continued evolution in this patient is striking as the typical ES has one epitope variant present in the plasma which remains constant ... ES8- 1a virus which contains the TSTLAEQVAW TW10 mutant was mutated using site-directed mutagenesis to produce gag with the six other variants present in the plasma, as well as wild type TW10 and T2 42N...
Ngày tải lên: 13/08/2014, 01:21
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx
... HuPAR2 backbone by site-directed mutagenesis with the following primer pair: 5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCTGAAGAA GATCTGATGGCAGCACCCACG 3' and 5'-CGTGGGTGCTGCCATCAGATCTTCT TCAGAAATAAGTTT ... region HuPAR2 primers and probe used were 5'-GCCTGTTGTACCTCTAATGTCACT-3' (forward) and 5'-GACCCAGGAAGAAAGACCGTAAG-3' (reverse); HuPAR2 probe, 5'-FAM TTCCTGAGCCACCTGCCACCTCCT BHQ3' Final reaction concentrations ... is a proline and explains the resistance of the murine species [45] Additionally, the initial receptor characterizations indicated that HuPAR2 was approximately ten-fold more functional than...
Ngày tải lên: 13/08/2014, 05:21
don t make me think a common sense approach to web usability phần 1 docx
... software and hardware products described in it Trademarks Throughout this book, trademarks are used Rather than put a trademark symbol in every occurrence of a trademarked name, we state that we are ... most satisfying thing has been people saying that it helped them get their job done better But what have you done for us lately? It only took about a year after the book appeared for people to ... work, but it was an important part of the “practices what it preaches” business If I was going to add any new material, I’d have to throw some of the existing stuff overboard, and I thought it all...
Ngày tải lên: 14/08/2014, 10:22
don t make me think a common sense approach to web usability phần 2 ppt
... not the site The actual Average User is kept in a hermetically sealed vault at the International Bureau of Standards in Geneva We’ll get around to talking about the best way to think about the ... not have been that easy to find in the first place and visitors may not know of an alternative The prospect of starting over isn t always that attractive And there’s also the “I’ve waited ten ... way: When I’m looking at a page that doesn t make me think, all the thought balloons over my head say things like “OK, there’s the _ And that’s a _ And there’s the thing that I want.” NOT...
Ngày tải lên: 14/08/2014, 10:22
don t make me think a common sense approach to web usability phần 3 doc
... instance, that a phrase in very large type is usually a headline that summarizes the story underneath it, and that text underneath a picture is either a caption that tells me what it’s a picture of, ... is instructions The main thing you need to know about instructions is that no one is going to read them—at least not until after repeated attempts at “muddling through” have failed And even then, ... flawed—where a heading spans things that aren t part of it, for instance—is like reading a carelessly constructed sentence (“Bill put the cat on the table for a minute because it was a little wobbly.”)...
Ngày tải lên: 14/08/2014, 10:22
don t make me think a common sense approach to web usability phần 4 ppsx
... me to the site’s Home page Having a Home button in sight at all times offers reassurance that no matter how lost I may get, I can always start over, like pressing a Reset button or using a “Get ... Partly because it just doesn t seem that important (After all, how important can it be? It’s not primary It’s not even secondary.) And there’s a tendency to think that by the time people get that ... page name, too > The name needs to be in the right place In the visual hierarchy of the page, the page name should appear to be framing the content that is unique to this page (After all, that’s...
Ngày tải lên: 14/08/2014, 10:22
don t make me think a common sense approach to web usability phần 5 ppsx
... active tab is in front of the other tabs This is the main thing that makes them feel like tabs—even more than the distinctive tab shape.16 To create this illusion, the active tab needs to be a ... > Don t use them instead of a page name There have been a lot of attempts to make the last item in the Breadcrumbs list double duty, eliminating the need for a separate page name Some sites have ... can retrace their steps Eventually the tale devolves into attempted cannibalism, grand larceny, and immolation, but basically it’s a story about how unpleasant it is to be lost 11 Actually, the...
Ngày tải lên: 14/08/2014, 10:22