don t be a drag interacting with the clipboard and drag and drop

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Ngày tải lên : 08/03/2014, 08:20
... CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) ... tetracycline-controlled transactivator (tTA) This construct (pTRE-HuD) was transiently transfected into Swiss 3T3 cells together with the pTetoff plasmid coding for the tTA-protein Under these conditions the PDB ... in the capability of the 52 nt CU-rich element to form the complexes C1 and C2 with extracts of untreated and PDB-treated fibroblasts This might be due to the fact that in vitro binding of the...
  • 16
  • 754
  • 0
Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Ngày tải lên : 16/03/2014, 12:20
... demand a dated condition report with both your signature and that of the representative accepting the car, the mileage clearly stated, and a detailed review of the condition of the car at the time ... payments and the total amount of all of the payments; the name and address of the dealer; and a toll-free telephone number for more information If the advertisements are broadcast, the information ... the term of the contract (usually a term of 24, 36 or 48 months) At the end of the contract a balance or a “balloon-note” amount remains The balloon amount is the value the financial institution...
  • 29
  • 503
  • 0
Báo cáo y học: "Gitelman’s syndrome with persistent hypokalemia - don’t forget licorice, alcohol, lemon juice, iced tea and salt depletion: a case report" ppsx

Báo cáo y học: "Gitelman’s syndrome with persistent hypokalemia - don’t forget licorice, alcohol, lemon juice, iced tea and salt depletion: a case report" ppsx

Ngày tải lên : 10/08/2014, 23:22
... hypokalemia of 1.0 mmol/L was evident The patient had started a new diet with restricted sodium intake He later explained that he had vomited the day before being admitted to our hospital; in retrospect, ... exacerbated his hyponatremia Last, the patient had progressive truncal weakness and finally presented with respiratory failure, necessitating temporary mechanical ventilation At this point, extreme ... patient was treated with a low dose of an aldosterone antagonist, the highest tolerated dose of magnesium, and potassium supplements By applying this therapeutic regimen, a stable hypokalemia...
  • 5
  • 396
  • 0
Interacting with the Outside World Using Simple IO Devices

Interacting with the Outside World Using Simple IO Devices

Ngày tải lên : 03/10/2013, 01:20
... mounted at the front panel so that the data can be inputted by an operator Thumbwheel switches are also found in conjunction with the programmable logic controller (PLC) as a standard input device ... “cursor” position can be read or written • Resetting the bit indicates, either an instruction being sent to the LCD or the execution status of the last instruction being read back ‘R/W’ Read/write LCD ... frequency variation can be verified by changing the delay count Program 2.2 Blink and send the data pattern stored in array The application is all about making a configurable LED arrays by sending the...
  • 24
  • 359
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Ngày tải lên : 19/02/2014, 05:20
... ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT ... GCGGAATTCTTATTTCCCAGCCTGTTGGGCCTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG GCGGAATTCTCTCACACCATTTTGCTGGT ... GCGGAATTCTCTCACACCATTTTGCTGGT GCGCTCGAGTTATTTCCCAGCCTGTTGGGCCTG GCGGGATCCCACACCATTTTGCTGGTACA GCGAAGCTTTTATTTGTCATCGTCATCCTTGTAGTCTTTCCCAGCCTGTTGGGCCTG GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG...
  • 14
  • 517
  • 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Ngày tải lên : 06/03/2014, 08:21
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the subring of R generated ... into (2.6) yields the upper bound of Theorem 1.1 In the language of the beginning of this section, we have taken A to be Spec RΣ and the map F to beThe set SY can be taken to be the set ... Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of this work was undertaken We also thank Hendrik Lenstra for useful comments...
  • 20
  • 478
  • 0
Báo cáo khoa học: "Don’t ‘have a clue’? Unsupervised co-learning of downward-entailing operators" pptx

Báo cáo khoa học: "Don’t ‘have a clue’? Unsupervised co-learning of downward-entailing operators" pptx

Ngày tải lên : 17/03/2014, 00:20
... for the language in question, and English is essentially the only case that does not t this description On the other hand, the fact that DLD09 applied their method for extraction of DE operators ... colearning algorithm that can extract DE operators in the many languages where a high-quality NPI DLD09 policies: (a) “NPI context” was defined as the part of the sentence to the left of the NPI up to the ... newswire articles Note that we cannot evaluate impact on textual inference because, to our knowledge, no publicly available textual-entailment system or evaluation data for Romanian exists We therefore...
  • 6
  • 370
  • 0
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Ngày tải lên : 23/03/2014, 10:21
... (b) assess the pathway of the interactions between VPg, eIF4E and the cap structure A glutathione S-transferase (GST) pull-down test from plant extracts was used to demonstrate that VPg can recruit ... at the wavelength of excitation (data not shown) The excitation wavelength was set at 258 nm Although there is a contribution of m7GDP absorption at this wavelength, with our optical system the ... recombinant GST and mixed with glutathione–Sepharose 4b After being washed, the fraction eluted with glutathione was analysed By SDS ⁄ PAGE contained this protein (Fig 4A, lane 3) As the interaction...
  • 11
  • 489
  • 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx

Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx

Ngày tải lên : 23/03/2014, 13:20
... architecture and the standard implementations of it admit practical, exploitable vulnerabilities that routinely leak sensitive traffic and that allow an active attacker remarkable leverage At the root ... that it begins transmitting at or just before the the first symbol of the targeted field is sent by the transmitter under attack, and end just after the last symbol of the field has been sent At ... replaces 4.3 Selective Jamming Attacks An attacker need not attempt to jam every transmitted frame The attacker can pick and choose which frames to attack in order to encourage the legitimate...
  • 16
  • 1.2K
  • 0
get a life, you don''t need a million to retire well 4th (2002)

get a life, you don''t need a million to retire well 4th (2002)

Ngày tải lên : 18/04/2014, 14:05
... retired contractor or other person familiar with the many pitfalls of construction to help guide them The fact that nonprofit work is usually unpaid doesn t alter the fact that, like any other work, ... are good that without much inconvenience we will have the opportunity to learn a great deal about almost anything that interests us, whether it be how to sculpt, read Latin, teach autistic children, ... GET A LIFE Finding the Time to Learn The desire and determination to learn can and should be cultivated as a life-long habit, not put off until the day after you retire, when it may be too late...
  • 374
  • 399
  • 0
learning to be a social worker in the 21st century

learning to be a social worker in the 21st century

Ngày tải lên : 27/05/2014, 13:25
... not adding value (IR legislation) What is the impact of these changes on the practicum and the educational institutions’ relationship with the sector and can we maintain separatist structures? ... Greater emphasis on ‘learning organizations’ and their continual evolution of practice throughout the workplace The importance of learning with others to ensure competition and innovation in a ... whilst being supported by skilled peers and experts (Billett 1994)  Theoretical framework: situated learning and the importance of a community of practice Situated learning and community of practice...
  • 16
  • 316
  • 0
cottey a., edmunds t., forster a. femocratic control of the military in postcommunist europe. guarding the guards. 2002

cottey a., edmunds t., forster a. femocratic control of the military in postcommunist europe. guarding the guards. 2002

Ngày tải lên : 04/06/2014, 00:37
... disputed nature of ‘nation’ and ‘state’ have drawn the military into politics in the former Yugoslavia The international context External international factors can have a significant impact on patterns ... statute’.45 There can be little doubt that the dominant executive figure is the defence minister and the President acts more as the helmsman of the ship of state in the 1997 constitution The fact ... democratic control of the military might also have a significant bearing on Central and Eastern European states’ relations with the West and their prospects for integration with the European Union...
  • 287
  • 428
  • 0
Don’t Get Personal Remember that on the GRE, you must assess arguments and answer questions based pdf

Don’t Get Personal Remember that on the GRE, you must assess arguments and answer questions based pdf

Ngày tải lên : 18/06/2014, 17:20
... be an adjective that describes animal in the way that solitary describes beast Therefore, the word that will contrast with the idea in the first unit is in opposition to solitary What is an antonym ... passage with its topic, but they are two very different things The topic or subject of a passage is what the passage is about The main idea, on the other hand, is what the writer wants to say ... Transitions Transitions are an essential element of effective writing, and they are important clues to organizational patterns and meaning Transitions signal the relationships between ideas; that is, they...
  • 25
  • 390
  • 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt

báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt

Ngày tải lên : 20/06/2014, 16:20
... opinion with more than 510,000 participants, found that Bavaria and BadenWuerttemberg had the highest satisfaction scores in Germany but East Germany's satisfaction is rising Limitations The advantage ... individual MiL in a representative sample of the German population to gather data for future comparisons with cancer and palliative care patients More specifically, the study aimed (i) to evaluate and ... German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland, and North Rhine-Westphalia) were most satisfied with their overall MiL Other surveys have also found that residents...
  • 8
  • 382
  • 0
Báo cáo hóa học: " Research Article A Hilbert-Type Linear Operator with the Norm and Its Applications" pdf

Báo cáo hóa học: " Research Article A Hilbert-Type Linear Operator with the Norm and Its Applications" pdf

Ngày tải lên : 22/06/2014, 02:20
... theoretical analysis and applications These inequalities and their integral forms have been recently extended or strengthened in 4–8 Zhao and Debnath obtained a Hilbert-Pachpatte’s reverse inequality ... been proved that 1.7 and 1.8 are two equivalent inequalities and their constant factors π/sin π/p and π/sin π/p 2p are the best possible When α 1, the expressions 1.7 and 1.8 can be reduced to ... applications,” Acta Mathematica Sinica, vol 49, no 2, pp 363–368, 2006 Chinese 19 B C Yang and Y H Zhu, “Inequalities for the Hurwitz zeta-function on the real axis,” Acta Scientiarum Naturalium...
  • 18
  • 253
  • 0
Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot

Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot

Ngày tải lên : 08/08/2014, 01:22
... growth – temperature relationships and growth rate between the six isolates Interestingly, isolates with the fastest growth at the lowest temperature (# 553 and 171) grew slowest at the highest temperature ... fungal growth on malt agar medium These parameters were all positively correlated to the parameters related to tree death after mass inoculation and negatively to that related to tree survival ... inoculations was always highly and positively correlated with the percentage of blue stained sapwood and negatively with the percentage of healthy sapwood, the two latter parameters being also...
  • 9
  • 308
  • 0
Báo cáo khoa hoc:" The Drosophila Anion Exchanger (DAE) lacks a detectable interaction with the spectrin cytoskeleton" pdf

Báo cáo khoa hoc:" The Drosophila Anion Exchanger (DAE) lacks a detectable interaction with the spectrin cytoskeleton" pdf

Ngày tải lên : 11/08/2014, 07:21
... near the N-terminus Classes E and D use an alternate transcription start site and an internal methionine start codon Classes B, J and D splice out an alternate exon which is located between two ... this region established a hierarchy of sequence identities with the highest between human AE2 and AE3, the next highest between DAE and AE2/3, and the lowest between AE1 and the others A 40 residue ... are associated with the spectrin cytoskeleton in Drosophila and mammals Further insights into these issues are likely to emerge as the membrane anchors that attach the spectrin cytoskeleton to the...
  • 9
  • 234
  • 0
Báo cáo y học: "A neurotropic herpesvirus infecting the gastropod, abalone, shares ancestry with oyster herpesvirus and a herpesvirus associated with the amphioxus genome" pps

Báo cáo y học: "A neurotropic herpesvirus infecting the gastropod, abalone, shares ancestry with oyster herpesvirus and a herpesvirus associated with the amphioxus genome" pps

Ngày tải lên : 12/08/2014, 02:20
... ClustalW[19] The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (2000 replicates) are shown next to the branches The scale bar for the branch ... J: Ganglioneuritis causing high mortalities in farmed Australian abalone (Haliotis laevigata and Haliotis rubra) Australian Veterinary Journal 2007, 85:188-193 NACA: Quarterly Aquatic Animal Disease ... vertebrates) One hypothesis to explain the diversity of viruses within vertebrates and the positioning of the mollusc viruses among them, rather than as an ancestral outgroup, is the existence...
  • 9
  • 261
  • 0
Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot

Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot

Ngày tải lên : 13/08/2014, 03:20
... setting, and helped in the statistical analysis AK participated in the design of the study and coordination and helped to draft the manuscript All authors read and approved the final manuscript ... affected the results and therefore the only determining factor was the technique itself The clinical notion that the additional equipment and manipulation associated with the ultrasound method ... it was noted that the IJV was overlying the carotid artery rather than being more lateral To avoid the carotid artery in these cases, a sideway approach of puncturing the IJV was used instead...
  • 8
  • 554
  • 0
Báo cáo y học: "Host proteins interacting with the Moloney murine leukemia virus integrase: Multiple transcriptional regulators and chromatin binding factors" pot

Báo cáo y học: "Host proteins interacting with the Moloney murine leukemia virus integrase: Multiple transcriptional regulators and chromatin binding factors" pot

Ngày tải lên : 13/08/2014, 05:20
... AF9, Brd2, Enx-1, and ABT1 interacted with the truncated fragment containing both the catalytic and the C-terminal domains TFIIE-β interacted with the amino terminus of MLV IN and Ku70 interacted ... 121 putative interacting proteins We chose to further characterize the interactions of 27 of these factors with MoMLV integrase and to test their interactions with HIV integrase A subset of the ... integration Early reports of mammalian and avian retroviral systems suggested that the selection of integration sites might be non-random with respect to the chromatin structure of the DNA target, and...
  • 23
  • 184
  • 0

Xem thêm