doesn apos t use table cells for the tiles

báo cáo hóa học:" The intra-articular use of ropivacaine for the control of post knee arthroscopy pain" doc

báo cáo hóa học:" The intra-articular use of ropivacaine for the control of post knee arthroscopy pain" doc

... recorded The data were analysed using T- test for VAS and Chisquare test for analgesic consumption Results No statistical difference regarding the VAS at the first hours was detected between the two ... 7.5 mg/ml at the end of surgery the event that there was no pain relief, 75 mg i.m diclophenac was injected The time to the first request for analgesia and the total analgesic requirements were ... that the promising results of cryocuff application necessitates its use after knee arthroscopy procedures The acute and most serious adverse effects of local anesthetics involve the CNS and the...

Ngày tải lên: 20/06/2014, 00:20

4 411 0
Designation: C 490 – 00a - Use of Apparatus for the Determination docx

Designation: C 490 – 00a - Use of Apparatus for the Determination docx

... and polished tips machined to the same shape as the contact end of the gage studs used in test specimens Except for the tips, which are attached after heat treatment, no part of the reference ... Bar—Place the reference bar in the instrument in the same position each time a comparator reading is taken Check the dial gage setting of the measuring device by use of the reference bar at least at the ... 50 % The temperature of the mixing water shall be 23.0 2.0°C [73.56 3.5°F] 8.2 Moist Storage Facility The temperature and humidity of the air in the moist storage facility shall conform to the...

Ngày tải lên: 10/07/2014, 23:20

4 389 0
Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

... Interestingly, the T cell line cross-reacted to the glycosylated mouse peptide, and the lower reactivity to the mouse glycopeptide than to the rat glycopeptide is most probably dependent on both ... containing IL-2 At the time of re-stimulation, an aliquot of the cell line was tested for antigen specificity Lathyritic CII was used for the first in vitro restimulation, to avoid contamination of pepsin-reactive ... significant R547 To investigate the role of T cells in the acute effector stage of clinical arthritis, newly activated T cells were injected into QD mice intravenously day after the antibody transfer...

Ngày tải lên: 09/08/2014, 01:24

7 435 1
Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

... between the TCR CDR3 loops and the cognate peptide Competing interests The authors declare that they have no competing interests the collaboration of the staff of the Central Cytometry Laboratory ... higher stability upon the galactosyl moiety The fact that the peptide synthesized with altered sugar orientation (Gal [5S]-Hyl peptide) activated T cells to a lesser degree favours such a hypothesis ... peptide stimulation Interestingly, the relative position of the two key elements within the cognate peptide for TCR stimulation is of crucial importance Slight changes, such as the introduction...

Ngày tải lên: 09/08/2014, 10:21

9 318 0
Báo cáo y học: "Drotrecogin alfa (activated): real-life use and outcomes for the UK" ppt

Báo cáo y học: "Drotrecogin alfa (activated): real-life use and outcomes for the UK" ppt

... in the audit but did not have local approval for use and did not use DrotAA at any time; and a concurrent admission from a unit that used DrotAA but before the first use in that unit All potential ... between DrotAA and control groups cannot be attributed directly to DrotAA, but to DrotAA and any residual selection bias Although sophisticated statistical techniques were used to attempt to ... nonparticipating units The large sample size, for both units and patients, and the basis of actual use of DrotAA (not subject to entry criteria used in the PROWESS study) enhance the generalizability...

Ngày tải lên: 13/08/2014, 10:20

12 302 0
Báo cáo sinh học: "Cumulative t-link threshold models for the genetic analysis of calving ease scores" pptx

Báo cáo sinh học: "Cumulative t-link threshold models for the genetic analysis of calving ease scores" pptx

... DIC to assess whether or not the CT model is a better data t than the CP model We further note that for the case where v is fixed, that MCMC mixing was not negatively affected using the CT model, ... leading to a more stable implementation with justification provided by Satagopan et al [38] but with their context being the stabilization of the Bayes factor estimator of Newton and Raftery [33] ... sufficient MCMC mixing under both models Table IV shows that the ESS from the CT model were found to be almost double those of the CP model, attributable to the twice as large post-burn-in period for...

Ngày tải lên: 14/08/2014, 13:22

24 263 0
An evaluation of land use development processes for the knowledge based urban development (KBUD) using agent based modelling

An evaluation of land use development processes for the knowledge based urban development (KBUD) using agent based modelling

... Thesis The thesis is divided into six chapters The structure of the document is as follows Chapter 1: Introduction The first section of Chapter is the introduction, which sets the context of the topic ... after the rise of the 21st century post-industrial cluster based development In the academic literature, their origin can be traced back to the economic stagnation of the 1970s and 1980s in the ... ecology for collaboration by attracting specific tenants, place them together on site in order to try and facilitate networking among them through events in order for them to be innovative and...

Ngày tải lên: 09/09/2015, 11:10

198 313 0
The characterization of soluble t cell receptors specific for the parasite toxoplasma gondii

The characterization of soluble t cell receptors specific for the parasite toxoplasma gondii

... migrate to lymph nodes T cells with TCRs specific for these antigens then contact and bind to the DCs presenting these antigens at the lymph nodes These T cells are then activated, secreting cytokines ... counterparts If they were to be used as potential therapeutics, their stabilities would be important as it would directly impact on their abilities to reach the target site of interest, maintain ... Titin, found in the heart, leading to death of the patients receiving the T cells transfusion 74 Thus, care has to be taken to ensure that the engineered TCRs not cross-react strongly with other...

Ngày tải lên: 09/09/2015, 11:31

164 367 0
Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model

Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model

... systemically administered 6-OHDA is unable to cross the blood-brain barrier, it has to be injected stereotactically into the substantia nigra, the nigrostriatal tract or the striatum to induce the ... reduce the inflammatory response in the brain Although current anti-inflammatory drugs are of great value in the treatment of PD, the disadvantage is that the use of them is systemic and they not ... and Ethell, 2008) The PQ and maneb models further support the theory that environmental toxins might have a role in the pathogenesis of PD So far, there is still no perfect model for the study...

Ngày tải lên: 11/09/2015, 09:05

200 311 0
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

... upstream HA fw GGGTTCCTGC^GGCCGCCGTTTCTGCTTTTTAAAGCTCATGT NotI P2 upstream HA rv TATGGATCCA^CTAGTTATGTAAATACAAACACAGAAAACCAA SpeI P3 downstream fw P4 GGGTTCCTGC^GGCCGCCTACTACTAATTGGCCAAAGTTTAA ... downstream HA rv GA NotI P5 Sca3 fw AGCACTTCCATATTTTAAAGTAATCTG P6 Sca3 rv TGCTCCTTAATCCAGGGAAA P7 ADK fw TTGCAGATGATTTTGCACCT P8 ADK rv GACCCCTTTGGGGTATCTGT P9 Neo fw GCTTGGGTGGAGAGGCTATT P10 ... catalytic base that deprotonates the 5’-hydroxyl of adenosine to initiate the transfer of phosphate from ATP to form AMP (Fig 1.3c) Substitution of this residue inactivates the enzyme The C-terminus...

Ngày tải lên: 26/11/2015, 09:54

135 365 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... upper 5'-TCT GCT GTG CCC TTC TCC TGT TGA-3' mTLR2 lower 5'-GGC CGC GTC GTT GTT CTC GT-3' mTLR4 upper 5'-AGC CGG AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper ... molecules thereof with cells that either home to the affected tissue or infiltrate the diseased area The observation that susceptibility to the development of chronic arthritis in patients with B.burgdorferi ... that bacterial lipoproteins directly stimulate alloreactive CTLs to proliferate and to secrete IFN-γ via TLR-2 adds another facet to the functional potential of T effector cells The fact that...

Ngày tải lên: 09/08/2014, 01:23

14 506 0
The Use of Plant Cell Biotechnology for the Production of Phytochemicals

The Use of Plant Cell Biotechnology for the Production of Phytochemicals

... requires at least three compartments: the plastids for the terpenoid moiety and tryptophan, the cytosol for decarboxylation of tryptophan, and the vacuole for the coupling of tryptamine with secologanin ... (up to 5.7-fold) The increase in total carotenoids suggests that the genetic modification affects the regulation of the whole carotenoid biosynthetic pathway in potato tubers, involving substantial ... first step consists of gathering various high-throughput data sets in addition to legacy data sets All of these data are then used in the second step to reconstruct the biochemical reaction networks...

Ngày tải lên: 25/10/2013, 05:20

19 759 1
Tài liệu Training document for the company-wide automation solution Totally Integrated Automation (T I A) doc

Tài liệu Training document for the company-wide automation solution Totally Integrated Automation (T I A) doc

... – Totally Integrated Automation (T I A) Learning goal: The reader is introduced to the philosophy of Totally Integrated Automation (T I A) Therefore the reader should receive an overview of the ... Systems The following modules can be used as teaching tools for the theme Industrial field bus systems Therefore the modules D1 and D2 show the uses of the AS-Interface and the modules D2 to ... operator panel OP with the integrated interface to the MPI and/or Profibus DP Notes for documentation In the associated chapters we explain the fundamental functions of the operator panel, typical...

Ngày tải lên: 25/01/2014, 09:20

61 623 0
Tài liệu TREES OF THE NORTHERN UNITED STATES THEIR STUDY, DESCRIPTION AND DETERMINATION FOR THE USE OF SCHOOLS AND PRIVATE STUDENTS doc

Tài liệu TREES OF THE NORTHERN UNITED STATES THEIR STUDY, DESCRIPTION AND DETERMINATION FOR THE USE OF SCHOOLS AND PRIVATE STUDENTS doc

... indicates that the notches extend about one fourth the distance to the base or midrib; cleft, that they extend one half the[ Pg 23] way; parted, about three fourths of the way; and divided, that the ... are characteristics worthy of notice: the strong, fragrant odor of the Spice-bush; the fetid odor of the Papaw; the aromatic taste of the Sweet Birch; the bitter taste of the Peach; the mucilaginous ... elementary way, the fruit are the parts to which the attention is directed; these all can be found and studied throughout the greater part of the year, and are just the parts that must be thoroughly...

Ngày tải lên: 13/02/2014, 12:20

295 570 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... not effectually kill all exposed cells Effect of heat High temperatures, on the other hand, will destroy any form of life, whether in the vegetative or latent stage The temperature at which the ... elimination of the bacteria after they are once introduced into the milk; others to the prevention of infection in the first place Straining the milk Most of the visible, solid particles of filth, ... the volatile emanations from the animals themselves and their excreta taint the air will often result in the absorption of these odors by the milk to such an extent as to seriously affect the flavor...

Ngày tải lên: 16/02/2014, 22:20

201 541 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site ... data not shown for others), but not by nonendothelial NIH 3T3 cells (data not shown), indicating that the cells maintained the physiological characteristic of acetylated-LDL uptake Lyve-1-positive ... and uterus; data not shown for the lung and heart), strongly suggesting that the tsA5 8T Ag-positive cells originated from ECs A subset of the cell populations from the lung and heart (data not shown)...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc

Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc

... with the control CEM cells, but not with H9 cells where there were no marked differences in cytostatic activity against the transfected vs nontransfected cells The molecular basis of the latter ... ice before storage in a )80 °C freezer until required for analysis A primer template mix was prepared through the ligation of a tailor-made oligo template (T; 5¢-TTTGTT TGTTTGTTTGTTTGGGCGGTGGAGGCGG-3¢) ... dilutions of the test compounds The cells were then allowed to proliferate at 37 °C for 72 h After this time period, control cells (in the absence of test compounds) were almost at the end of the...

Ngày tải lên: 20/02/2014, 01:20

11 506 0
Théorie des Fonctions Elliptiques, by Charles Briot and Jean Claude Bouquet This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever docx

Théorie des Fonctions Elliptiques, by Charles Briot and Jean Claude Bouquet This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever docx

... and the Online Distributed Proofreading Team at http://www.pgdp.net (The original copy of this book was generously made available for scanning by the Department of Mathematics at the University ... toutes contrefaỗons, soit du texte, soit des gravures, et toutes traductions, faites au mộpris de leurs droits Le dộp t lộgal de cet Ouvrage a t fait Paris, et toutes les formalitộs prescrites par ... modications mineures ont t apportộes la prộsentation, lorthographe, la ponctuation et aux notations mathộmatiques Le A chier L TEX source contient les notes sur ces corrections Ce chier est optimisộ...

Ngày tải lên: 06/03/2014, 16:20

636 824 0
Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc

Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc

... starting with the bottom then top tie or band Lift the mask or respirator away from the face and discard it into the designated waste receptacle 36 Removing a Particulate Respirator • Lift the ... bottom elastic over your head first • Then lift off the top elastic • Discard PPE Use in Healthcare Settings The bottom elastic should be lifted over the head first Then remove the top elastic ... Use in Healthcare Settings The last item of PPE to be donned is a pair of gloves Be sure to select the type of glove needed for the task in the size that best fits you Insert each hand into the...

Ngày tải lên: 08/03/2014, 13:20

49 645 0
w