distinguish library functions and user defined functions in c
Stored Procedures, Triggers, and User-Defined Functions on DB2 Universal Database for iSeries doc
... proc_cuscrd = proc_cuscrd +(proc_cuscrd * i_perinc);UPDATE ordapplib.customer 11SET cuscrd = proc_cuscrdWHERE CURRENT OF c1 ;SET numrec = numrec + 1;FETCH c1 INTO proc_cusnbr, proc_cuscrd; 12END ... numrec = 0;fetch_loop: 1LOOP FETCH c1 INTO proc_cusnbr, proc_cuscrd; IF SQLCODE = 0 THEN SET proc_cuscrd = proc_cuscrd * 1.2; UPDATE ordapplib.customer SET cuscrd = proc_cuscrd WHERE CURRENT ... Procedures, Triggers, and User- Defined Functions on DB2 Universal Database for iSeriesSET numrec = 0;OPEN c1 ; 8FETCH c1 INTO proc_cusnbr, proc_cuscrd; 9WHILE at_end = 0 DO 10SET proc_cuscrd...
- 594
- 3,044
- 0
Tài liệu User Defined Functions doc
... như c c đối tượng kh c trong Microsoft SQL Server mà chúng tôi đã trình bày trư c đây ở c c chương trư c, c c bạn c hai (2) c ch để c thể tạo mới một UDFs: sử dụng c c câu lệnh T-SQL ho c dùng ... bạn chỉ định kiểu này, UDFs trở nên rất giống c c Stored Procedure. Nó cho phép th c hiện c c câu lệnh SELECT ph c tạp, hơn nữa nó c n cho phép th c hiện c c câu lệnh logic kh c như UPDATE, INSERT ... đư c dựa trên c c tham số đầu vào đã nhận. Không chỉ UDFs mà tất c c c hàm nói chung (C c phiên bản SQL Server trư c đây cung c p c c hàm đư c cài đặt sẵn như getdate(), object_name(),… ) c ...
- 5
- 559
- 4
Tài liệu Creating User-Defined Functions pdf
... SELECT statement. Creating User- Defined Functions You can create your own user- defined functions in SQL Server. For example, you might want to create your own function to compute the discounted ... You can also create functions using Enterprise Manager. You do this by clicking the right mouse button on the User Defined Functions node in the Databases folder and selecting New User Defined ... Using Scalar Functions Scalar functions return a single value. Listing 4.2 shows the DiscountPrice.sql script that creates the DiscountPrice() function, which returns the original price of...
- 7
- 274
- 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot
... of LDC achieves domain independence by restricting itself to (a) a domain-independent. linguistically-motivated phrase-structure grammar [6] and (b) and the domain-specific files produced by ... that can occur in the "layered" domains of interest [1]. Finally, the macro file contains the meanings of modifiers, roughly in the form in which they were acquired using the specification ... paper is concerned only with vocabulary acquisition, which occurs in three stages. In Stage 1, Prep asks the user to name each ent~.ty, or conceptual data item, of the domain. As each entity...
- 5
- 452
- 0
Báo cáo khoa học: "User-Defined Nonmonotonicity in Unification-Based Formalisms" pptx
... The user can assign nonmonotonic information to a nonmonotonic sort by calling a nonmonotonic definition as defined in the previous section. The ac- tual nonmonotonic rule occurring within ... nonmonotonic constructions. The main idea in their approach is that each node in a feature struc- ture consists of a nonmonotonic sort. Such sorts can contain two different kinds of information, ... the class; isa its parent in the hierarchy; requires a structure. Thus, each member in the inheritance hierarchy is called a class, which is defined by giving it a name and a parent in...
- 7
- 279
- 0
Tài liệu Executing SQL Server User-Defined Scalar Functions doc
... [ Team LiB ] Recipe 2.13 Executing SQL Server User- Defined Scalar Functions Problem Your SQL Server 2000 database includes a user- defined function that returns a scalar value. You want ... function using ADO.NET. Solution Invoke the function as you would a query or stored procedure. The sample code, as shown in Example 2-16, uses a single SQL Server function: ExtendedPrice Calculates ... ExtendedPrice Calculates and returns the extended price for an order line item based on the unit price, quantity, and discount. Example 2-16. SQL Server function: ExtendedPrice CREATE FUNCTION dbo.ExtendedPrice...
- 2
- 299
- 1
NOTES ON THE ROLE OF EDUCATION IN PRODUCTION FUNCTIONS AND GROWTH ACCOUNTING pot
... regressions,except that the coefficient of schooling is significantly higher.7 EDUCATION IN PRODUCTION FUNCTIONS AND GROWTH ACCOUNTING79the percentage completing high school and more (from 28 in 1940 ... quality and quantity of schooling in the cross-sectional data, and the "total" coefficient associated withchanges in total "reproducible" human capital (including that producedat ... weighting the two educational distributions by the base(weight) period iearnings,aggregating and computing the percentage change. EDUCATION IN PRODUCTION FUNCTIONS AND GROWTH ACCOUNTING 99TABLE...
- 59
- 595
- 0
Báo cáo khoa học: Enzymes in organic media Forms, functions and applications potx
... a liquid. Cavitation provides a source ofenergy which can facilitate chemical processes. In thiscase, cavitation is an induced bubble activity. Cavitationcan generate very high local pressure ... was the sonication effect. In the case of organic halides, the relative increases underultrasonication were CCl4>CH2Cl2>CHCl3. Thereviewer concluded that it was difficult to analyze ... denaturingconditions: freezing and drying. Cryoprotectants (veryheterogeneous as far as chemical structures are concerned(e.g. sugars, amino acids, polyols, salts, etc.) preventstructural...
- 9
- 497
- 0
Báo cáo khoa học: Functions and cellular localization of cysteine desulfurase and selenocysteine lyase in Trypanosoma brucei pot
... the eukaryotic cell (seebelow).RNAi knockdown of SCLAn RNAi cell line was prepared by introducing intothe insect (procyclic) stage of T. brucei strain 29-13 apZJMb vector containing a 415 bp ... and selenocysteine substrateswere measured in the noninduced and RNAi-inducedknockdown cells for SCL characterized above, and also in the noninduced and Nfs RNAi-induced cellsdescribed earlier ... either Nfs or SCL protein leads to a dramatic decrease in bothCysD and selenocysteine lyase activities concurrently in the mitochondrion and the cytosolic fractions. Because loss of Nfs causes a growth...
- 11
- 326
- 0
Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot
... 5.9AAAA5′-Rb:CCCC GC CCCCCCN2TransitionalpHTransitionalpHN3/4N2-3′ 6.4CGC5′-RET:CCC GC CCCCC GCCCClass I-3′ 6.6CA5´- c- Myc:CCCCCC CACCTTCCCCCC TCCCCA-3′ 6.6TTCCT5´-Bcl-2:CCCCCCC GCTCCCGC ... 6AT5′-3′--3′-5′ATATATATATTATATATAG C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C G C 14-base overhang5-baseoverhang**(i)(ii)(iii)(iv)ABFig. 4. (A) Proposed equilibrating ... 6.6TTCCT5´-Bcl-2:CCCCCCC GCTCCCGC CCCCCCC GCGCCCGN6/8N2/5N6/7Class II5′3′3′5′ c- Myc Bcl-2VEGFRETRb3′5′3′5′3′5′Fig. 3. Sequences and folding patterns of i-motifs in the two proposed classes of...
- 11
- 366
- 0
Báo cáo khoa học: Gene duplication and separation of functions in aB-crystallin from zebrafish (Danio rerio) pptx
... toamplify the coding sequence and incorporate appropriaterestriction sites were: ZfaB2-5Â, GCAGAAGAGGCCCAGACTCCATATGGAC; ZfaB2-3Â, CTCGAGAGTTGACGTTTAGCATCTTTAC. The sequence of the expression clonewas ... amplification of genomic DNA: sense 5Â-GCCGACGTGATCTCCTCATT-3Â; antisense 5Â-CCAACAGGGACACGGTATTT-3Â. Cycle parameters were: 94 C for 15 s,55 C for 30 s, and 72 C for 1 min. Aliquots from eachreaction ... Gene sharing by delta-crystallin and argininosuc-cinate lyase. Proc Natl Acad Sci USA 85, 3479–3483.33 Hochachka PW & Somero GN (2002) BiochemicalAdaptation: Mechanism and Process in PhysiologicalEvolution....
- 10
- 372
- 0
Báo cáo toán học: "Parking functions, stack-sortable permutations, and spaces of paths in the Johnson graph" docx
... permutations, to Michael Kleber and Anders Buch for suggesting the connection between initial positions and parking functions, and to Sara Billey for many useful comments, including (but not limited to)the ... ,v(r)}↑(as increasing sequences) for all r =1, n, where, for a set S, S↑ is the sequence obtainedby arranging the elements of S in increasing order.the electronic journal of combinatorics 9(2) ... requiring that the non-strict inequalities be in fact equalities. Howmany such non-strict inequalities are there? We have such an inequality each time anthe electronic journal of combinatorics...
- 11
- 311
- 0
Báo cáo khoa học: "Linear and non-linear functions of volume index to estimate woody biomass in high density young poplar stands" docx
... These included two fast growing, inter-specific (Populus trichocarpa × P deltoides)hybrid clones (Beaupré and Raspalje), two nativeAmerican P trichocarpa clones (Columbia ... directions(d1 and d2) since a stem cross-section is notalways perfectly circular. Then, volumeindex calculation is more accurate whenusing the product d1·d2 rather than[(d1 ... to H·D2 in a sim-ple linear model passing through the origin. Original articleLinear and non-linear functions of volume indexto estimate woody biomass in high densityyoung...
- 11
- 298
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25