displaying the string value for part of a date

... (5' ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA 3') and VP22 R8 (5' ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCTGGACCCTCGACGGGCCGTCTGGGGCGAGA 3') Additionally, the gene for PA63 was PCR amplified from pGPA using ... Construction of DNA vaccines The DNA vaccine pGPA contains the signal sequence for human plasminogen activator fused to the N-terminus of the gene for the 63 kDa fragment of PA [19] and was a kind ... we evaluate the potential of VP22 to enhance DNA vaccines against anthrax The spore-forming bacterium Bacillus anthracis causes the disease anthrax The current UK-licensed vaccine is an alum-precipitated...

Ngày tải lên: 14/08/2014, 19:22

... economic value in Northeast region ( Acacia hybrid -3tree, midland tea plant, star anise and black cardamom);orientation of spatial rational use of bioclimatic resources in agricultural and forestry ... results of bioclimatic adaptation in the Northeast region of Vietnam for development of Acacia hybrid Based on a Liebig's Law of the minimum (1840) and Shelford’ law of toletance (1913), based on the ... 3.3.3.2.Results of evaluation and classification of appropriate levels The evaluation was conducted by using method of calculating the mean with specific criteria for each subject The average score value of...

Ngày tải lên: 29/08/2014, 15:53

... years, e.g Data Exchange Wales initiative (DEWi) data, information from primary schools via the transition plan, gender-specific data and the national core data set information Find school data ... about the learning environment as soon as possible • If appropriate, share the ideas put forward with SMT/other teachers/Heads of Department as part of a whole-school approach • Request a regular ... special school and/or the appropriate head(s) of department in a secondary school, a member of the school’s senior management team (SMT) or the LA advisory team, or a tutor in initial teacher training...

Ngày tải lên: 10/03/2014, 05:20

... H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... )76) of the mouse iNOS promoter plus the downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 ... (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA The oligonucleotides were annealed and labeled with [32P]dCTP[aP] Binding reactions were performed (20 lL of the total volume)...

Ngày tải lên: 17/03/2014, 10:20

... Ta adunata para anthropois dunata para to Theo estin.] Mark x 27 [Greek: Para anthropois adunaton, all' ou para Theo; punta gar dunata para to Theo] Matt xix 26 [Greek: Para anthropois touto adunaton ... rising of the Jews under Barcochba; Judith is Judaea, Nebuchadnezzar Trajan; Assyria stands for Syria, Nineveh for Antioch, Arphaxad for a Parthian king Arsaces, Ecbatana for Nisibis or perhaps Batnae; ... autois.] _Matt._ xvii 11-13 [Greek: Aelias men erchetai apokatastaesei panta, lego de humin hoti Aelias aedae aelthen kai ouk epegnosan auton, alla epoiaesan auto hosa aethelaesan, [outos kai ho uios...

Ngày tải lên: 17/03/2014, 15:20

... company; all partners in the case of a partnership; and the owner in the case of a private enterprise shall be liable for the truthfulness and accuracy of the amount certified as legal capital ... company chairman and the director (general director) in the case of a limited liability company; the chairman of the board of management and the director (general director) in the case of a shareholding ... chairman of the board of management and director (general director) in the case of a shareholding company; all partners in the case of a partnership; and the owner in the case of a private enterprise...

Ngày tải lên: 27/03/2014, 10:15

... In fact, there is a whole spectrum of explanatory and pragmatic trials [5] The second level of reporting is related to the appraisal of the effect of the health service Appraisal means that an ... is based on the levels of assessment and appraisal as shown in Table The appraisal of health care services presumes that preferences can be measured and can be made available to the policy and ... properties of a therapy but not all therapies may cover the patients’ preferences The obtained information is rather important as the consideration of patients’ preferences was requested as part of evidence-based...

Ngày tải lên: 20/06/2014, 15:20

... interpretations of the chemical raw data All authors read and approved the final manuscript Acknowledgements Part of this work was presented at the 111th Annual General Meeting of the American Society for Microbiology, ... the aromatic core part of a FQ has not yet been reported Our aim was to characterize the basic degradation scheme for PRA in G striatum and to attempt the identification of new types of metabolites, ... clinical strains Furthermore, a FQ-resistant strain of E coli, isolated from sewage sludge, contained the aminoglycoside transacetylase gene aac(6’)-Ib-cr and was capable of modifying ciprofloxacin...

Ngày tải lên: 20/06/2014, 21:20

... China Authors’ contributions HH, DW and QW carried out the design of the study and performed the analysis QZ participated in its design and coordination All authors read and approved the final manuscript ... sequences and NA random variable sequences are the most important and special cases of pairwise NQD random variable sequences, then we have the following results as two corollaries of Theorems 2.1 and ... Foundation (2010GXNSFA013120) The authors are very grateful to the referees and the editors for their valuable comments and some helpful suggestions that improved the clarity and readability of the...

Ngày tải lên: 20/06/2014, 22:20

... independent random variables have been extended to dependent random variables by many authors The concept of negatively associated random variables was introduced by Alam and Saxena [6] and carefully ... negatively associated and negatively dependent random variables and then they proved the case of mean zero by using these results However, this approach is not good For the case of negatively associated ... ∞ for all  > n=1 i=1 When mean zero condition is imposed in Theorem 1.4, Chen et al [9] obtained a partially extended version of Theorem 1.3 for negatively associated random variables The partially...

Ngày tải lên: 20/06/2014, 22:20

... interpretations of the chemical raw data All authors read and approved the final manuscript Acknowledgements Part of this work was presented at the 111th Annual General Meeting of the American Society for Microbiology, ... the aromatic core part of a FQ has not yet been reported Our aim was to characterize the basic degradation scheme for PRA in G striatum and to attempt the identification of new types of metabolites, ... clinical strains Furthermore, a FQ-resistant strain of E coli, isolated from sewage sludge, contained the aminoglycoside transacetylase gene aac(6’)-Ib-cr and was capable of modifying ciprofloxacin...

Ngày tải lên: 21/06/2014, 17:20

... to thank the referee and the editor for their careful reading of the manuscript and their many valuable comments and suggestions The research was supported by the Natural Science Foundation of ... introduced a notion of convex metric space, which is more general space, and each linear normed space is a special example of the space Late on, Ciric et al proved the convergence of an Ishikawa type ... Fixed Point Theory and Applications considered the Ishikawa iteration process to approximate the common fixed point of mean nonexpansive mappings in uniformly convex Banach space Takahashi first...

Ngày tải lên: 21/06/2014, 20:20

... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i for ... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... is nonzero for only finitely many negative values of i) then the residue of F (z) is res F (z) = u−1 An elementary fact about formal Laurent series is the change of variables formula for residues:...

Ngày tải lên: 07/08/2014, 06:22

... that the conditional expectation of a performance future offspring of some animal i of the parent population is equal to and the variance given the performances of all the ,i d Y of a animals ... performances of the offspring of the candidate for selection The selection criterion (21) is then a true measure of the candidate’s value, and can be considered as an approximation of the criterion ... expressions are given numerical values after estimates of genetic values and of variance components are available General formulae can be derived that take into account all performances of the whole...

Ngày tải lên: 09/08/2014, 18:21

... of persons with schizophrenia [30], and also because this scale was already part of the SfW program in Scandinavia and the feedback from the SfW instructors about the ability of the participants ... was defined as a change between - cm and cm, and an increase was defined as cm increase or more For weight a decrease was defined as a loss of at least kg, stable weight was a Page of 12 change ... to play any role here The choice of the short-form of the SWN scale in this study was governed by the history of the scale as it was developed and validated in a clinical trial measuring the subjective...

Ngày tải lên: 11/08/2014, 16:22

... group the participant has been randomised to at the end of 12 months treatment At the end of the study, these guesses will be compared against chance Statistical analysis Statistical analysis for ... because it is providing an acceptable standard of care In the latter case, the implication might be that better training and support for existing staff is required rather than the formation of a ... be aware of Costs of time off work will be calculated from the patient’s own account of their salary and normal expectations of overtime and informal care to the depressed patient will be calculated...

Ngày tải lên: 11/08/2014, 16:22

... the action of the cilia that continue to clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of ... view of the foreign body in the supero medial aspect of the maxillary sinus Intraoperative endoscopic view of the foreign body in the supero medial aspect of the maxillary sinus Figure Intraoperative ... left maxillary sinus Computed tomography scan (coronal plane) showing the foreignof the upper first the supero medial aspect of the maxillary Figure sinus and partial mucosal thickening of the...

Ngày tải lên: 11/08/2014, 23:22

... database Statistical Analysis All descriptive statistics were presented as means and standard deviations for continuous variables, and as absolute and relative frequencies for categorical variables ... in dialysis or have you had a kidney transplantation?”); at least one macrovascular complication ("Has a doctor told you that you have had a myocardial infarction, angina?”, “Have you Medical reimbursements ... Surprisingly, compared to the impact of microvascular complications, the effect of macrovascular complications was limited (about a 3-decrease only in the BA dimension) Macrovascular disease was defined...

Ngày tải lên: 12/08/2014, 01:21

... Predicted values were close to actual values in the prediction models for IAA, TIAA and TAA It was concluded that the IAA, TIAA and TAA contents of both maize- and wheat-DDGS can be predicted from their ... prediction equations for indispensable amino acids (IAA), total indispensable amino acid (TIAA) and total amino acid (TAA) contents using nutrient composition data available in literature The relationship ... performance of broilers whereas phytase had no effect There is substantial data about the nutritional value of maize- and wheat-DDGS for pigs but there is no information about the effect of dietary fibre...

Ngày tải lên: 22/12/2014, 16:42

... Following that, the value of action is further evaluated If action has a value of "ff", an onEnterFrame event handler is attached to the messages_mc instance This event handler advances the messages_mc ... the last part of the conditional statement (else) is executed If this part of the statement is executed, the function has been passed a value of "ff" or "rew" This part of the conditional statement ... fast-forward or rewind), and tells the messages_mc instance to play() If the function is passed a value of "stop", the second part of the conditional statement is executed This part of the statement...

Ngày tải lên: 24/12/2013, 07:17