... conformation, a dominant and potentially over-dominant QTL explaining all of the QTL variance maps to around 80–118 cM on the consensus map Yonash et al., [23] find partial and overdominance for QTL affecting ... mat (4) pat + mat (4) pat + mat (4) null (1) null (1) null (1) null (1) null (1) add (2) add (2) pat (5) mat (6) additive additive + dominant paternal + maternal paternal maternal dominant parent ... map, is within a marker interval associated with many fat and carcass traits in chickens [22,24,30,43,44] Furthermore, McElroy et al., [28] and Tuiskula-Haavisto et al., [26] both find maternally...
Ngày tải lên: 14/08/2014, 13:21
... the precipitation enabling larger water amounts to percolate into deeper soil layers The statistical evaluation has resulted in a finding that only 54–71% of the amount of water fallen on the ... at a 50 mm precipitation event Similar results were also obtained by Minďáš et al (2001) Statistical evaluation of the measured totals is summarized in Table CONCLUSION In summary, in our research ... interaction with plants, soil, and water balance – which was already pointed out by Papritz et al (1991) and Flückiger and Braun et al (1992) The differences in the soil water balance between the...
Ngày tải lên: 07/08/2014, 03:22
báo cáo khoa học: "Severe sepsis caused by Aeromonas hydrophila in a patient using tocilizumab: a case report" pps
... hydrophila was resistant to penicillin, ampicillin, ampicillin-sulbactam, and first- and second-generation cephalosporins, and susceptible to piperacillin, third-generation cephalosporins, aminoglycosides, ... bradycardia An electrocardiogram showed ST segment elevation at I and aVL Echocardiography showed left posterolateral ventricular wall dysfunction Coronary angiography showed patent coronary arteries ... with a heart rate of 96 bpm She was jaundiced, but had no signs of palmar erythema, ankle edema, finger clubbing, spider nevi or evidence of skin injury or infection She had abdominal pain with...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "Distal migration of a floating carotid thrombus in a patient using oral contraceptives: a case report" potx
... ipsilateral MCA (Figure 4) Local intra-arterial thrombolysis followed by percutaneous transluminal cerebral balloon angioplasty was performed Although partial recanalization of the left MCA was achieved, ... ultramicroscopic ulcerations and thrombi, even in smooth appearing plaques [7] Oral contraceptives and smoking may activate the coagulation cascade in the carotid bifurcation where the arterial intima ... heparin and warfarin However, the clinical course of our patient should alert clinicians that some floating thrombi are resistant to conservative therapy and have a risk of distal migration that...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo sinh học: " Genetic parameters of meat technological quality traits in a grand-parental commercial line of turkey" pot
... the rate of pH fall Further investigations are now required to increase the accuracy of the genetic parameter estimates by using both larger data sets and including new meat traits such as water- holding ... birds were slaughtered in a commercial plant (LDC, Sablé-sur-Sarthe, France) following usual commercial practices 626 É Le Bihan-Duval et al 2.2 Muscle sampling and meat trait measurements The ... chroma (C) and Hue (H) values were also calculated as C = (a 2 + b∗2 ) and H = tan−1 (b∗ /a ) Chroma is a measure of the colour intensity which increases when a and/or b∗ increases Hue indicates...
Ngày tải lên: 14/08/2014, 13:22
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx
... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 643:CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC ... ******************************************************************** p-env3f Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmERV Chr 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAGAAAAAGGGCAAGAACATTTGAC 272 *********************************************.********************** ... 643:CAGGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGAGAGAACAATGAAGAAGAGGCGGC 642:CCTGATAGCGGCGGACCTCTCATTGATCTTCTCACAGAGGACCCCCCCGCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC...
Ngày tải lên: 13/08/2014, 01:20
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM
... TCE degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had a BET surface area of 50-m2/g ... in one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV concentrating radiation System (Yves et al., 1996) In this process, major toxic ... (PCE) in both natural and drinking waters poses a potentially serious environmental problem, since they may be carcinogenic and/or toxic They are readily removed from groundwater using well pump in...
Ngày tải lên: 05/09/2013, 08:40
A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process
... profile of TAD supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... on the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector ... sodium acetate concentrations were estimated using this linear correlation and their verification (by gas chromatograph analysis) are shown in Table The estimated error was less than %, in four...
Ngày tải lên: 05/09/2013, 08:40
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
... al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in this ... total bacterial count in the untreated water dropped rapidly at first stage and slowly at second stage in the SC-CO2 treatment and the inactivation rate increased as the temperature increased ... determined the total bacterial count using the standard plate counting method One ml of appropriate dilutions of samples was inoculated in standard plate count agar (Nihon Pharmaceutical Co.,...
Ngày tải lên: 05/09/2013, 09:38
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... steam and process hot water demands are also equality constraints [19] The inequality constraints are represented by the allowable ranges of variation of the decision variables, presented in Table ... the beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and to define main decision variables ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with...
Ngày tải lên: 05/09/2013, 16:30
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...
Ngày tải lên: 05/09/2013, 17:03
Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc
... pause in computer use, students can analyze what they have learned and done, share information with others, and plan their next steps After using computers, students can again analyze and share ... teachers for information, and instead can work together to find and share knowledge All the same benefits of cooperative learning presented above in the normal classroom apply equally in information ... researched information in the development of setting, character, and plot In addition, essays are evaluated for language use, particularly for one or two grammatical items on which the teacher wanted...
Ngày tải lên: 06/09/2013, 05:10
Curing an air lock in a hot water pipe
... A Further method was sent in by a user, Dave Maynard: When needing to pass mains cold water pressure across to air locked hot water supply using kitchen mixer taps: Easier than trying to find ... now unable to exit from the hand blocked tap outlet, will instead flow across to the hot water pipe causing a backflow in the hot water system, clearing the airlock Note: If you have a similarly ... find another tap and having to use a long hose which may, anyway, not fit the shape of some taps Simpler than playing around with washing machine hoses Procedure: 1)Squeeze the single mixer tap...
Ngày tải lên: 17/12/2013, 10:45
Tài liệu Using Indexers in a Windows Application doc
... class that returns a PhoneNumber and accepts a single Name parameter Implement this indexer in the same way as the first one (again note that PhoneNumber is a struct and therefore always has a ... indexers In the PhoneBook.cs source file, add a public read-only indexer that returns a Name and accepts a single PhoneNumber parameter to the PhoneBook class Leave the body of the get accessor blank ... item in the array that matches The first argument to IndexOf is the array to search through (phoneNumbers) The second argument to IndexOf is the item you are searching for IndexOf returns the integer...
Ngày tải lên: 24/12/2013, 09:16
Tài liệu Using XPath to Query Data in a DataSet doc
... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... [Order Details]", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... = new DataSet("Orders_OrderDetails"); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]);...
Ngày tải lên: 26/01/2014, 10:20
Tài liệu Báo cáo "Numerical simulations of overland floods in urban areas using a conservative Godunov-type scheme " pptx
Ngày tải lên: 13/02/2014, 12:20
Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx
... subtropical rangeland offers predominantly C plants for grazing cattle, milk casein was enriched in 13 C relative to C3 plants Amino acids were added to the C3 and C4 sugar diets to a final concentration ... CO2 was collected on a liquid nitrogen trap After remaining sample gas was pumped away (predominantly N2), sample CO2 was thawed, recondensed in a pyrex tube, and flame sealed Collected CO2 was ... tested with ANOVA The effect of the amino acid supplement on egg ␦13C was tested in the 1998 data set with ANOVA, including sugar type, day, and the interaction between sugar and amino acids as effects...
Ngày tải lên: 13/02/2014, 16:20
Tài liệu In the know - Using information to make better decisions: a discussion paper docx
... similar areas and the national picture; and c) data collection and analysis includes reference to the needs of groups at risk of disadvantage and geographic areas Alastair Evans is the Research Manager ... to interpret 86 Analytical skills are vital both for providing the right information for decision makers, and for extracting meaning from data and information in a proactive fashion that may ... presenting information to add value, instead of the majority of effort being spent on gathering data and dropping it into standard templates There are also many examples in management literature of...
Ngày tải lên: 18/02/2014, 05:20
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc
... automatically transcribed dialog corpora by modeling dialogs within a probabilistic framework that accounts for transcription errors in a principled way This method may lead to many interesting ... future applications, such as continuous learning of a user model while the dialog system is on-line, enabling automatic adaptation References −5 Truth Manual EM Automatic −6 −7 −8 Manual EM Automatic ... estimated θ using the following three methods: Manual: Let θ be the maximum likelihood estimate using manually transcribed data, i.e., D θasu = PKasu KD a asu Automatic: Let θ be the maximum...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
... ~'¢ ' "Hai arigatou gozaimasu Kyoto Kanko Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, "A hai arigatou gozaimasu e Kyoto Kanko ... actual utterance (A) No lacking in the meaning of the actual utterance, and with perfect expression (B) No lacking in meaning, but with slightly awkward expression (C) Slightly lacking in meaning ... 1245(-8.5) The values inside brackets are the rate of decrease 4.3 More Applicable for a Result Having a Few Errors In EPC+SSC, the rate of decrease was 8.5%, and the decrease was obtained in all type...
Ngày tải lên: 20/02/2014, 18:20