directional analysis of bloodstain patterns with a computer

... which are often sorely lacking in empirical justifications, and analysis of online communities, which are often rife with available metadata but produce content far faster than it can be analyzed ... Signal Processing, ICASSP, pages 493–496 Ryan S.J.D Baker and Kalina Yacef 2009 The state of educational data mining in 2009: a review and future visions In Journal of Educational Data Mining, pages ... Kentucky Assembly, marshaled, classed railroadco, statute, Alabama, steamboats, Waterman’s, mulattoes, man-trap Free Region (R1) Slave Region (R2) apprenticed, overseer’s, Federal Army, manumitting,...

Ngày tải lên: 23/03/2014, 14:20

... literature Evaluations of subsite maps of rice and barley a- amylases are thus also presented MATERIALS AND METHODS SUMA software: subsite mapping of amylases This software calculates the apparent ... measured earlier SUMA is freely available for research and educational purposes (E-mail: gyemant@tigris.klte.hu) Action patterns of a- amylases Action patterns are summarized in the tables below: Table ... Subsite mapping of barley a- amylase isozyme – justification of a ‘6 + 2’ model Action patterns of barley a- amylase isozymes and were published by MacGregor et al [10] on maltooligosaccharides and their...

Ngày tải lên: 08/03/2014, 09:20

... selection was made for 44 generations in four isofemale lines originating in a natural population caught in Asturias (North of Spain) In each generation, the phenotypes of 60 males and 60 females were ... dorsocentral e.b appear The scutellum does not decanalize in any case Chromosomal combination BAB is also positionally decanalized in ADC-4 ; moresome individuals with more than e.b In ADC-7, BAB has ... some positional decanalization, and ABB is clearly positionally and numerically decanalized These observations are statistically proved by positional standard test a posteriori (table 4), in which...

Ngày tải lên: 09/08/2014, 22:22

... database Additional file 9: Figure S2 - Validation of PEGs by qRT-PCR Expression patterns of APETALA1, APETALA3, PISTILLATA, AGAMOUS, SEPALATA3, CLAVATA1, MYB21, MYB24, RBCS-1B, SBPase, a- glucosidase, ... statistical analysis and manuscript writing VAA contributed to data analysis, phylogenetic analysis, drafting and editing of the manuscript CAPT and MJOE carried out RNA extractions and cDNA synthesis ... analysis Additional file 14: Figure S5 - U gibba mitochondrial region used in phylogenetic analysis (A) Mitochondrial genome comparison of Arabidopsis thaliana, Brassica napus, Carica papaya,...

Ngày tải lên: 11/08/2014, 11:21

... elevation and another 16 articles gave an account on rare grafting material Of the remaining 65 articles only in 30 studies the histomorphological parameter TBV was evaluable That means that this parameter ... sum of both values was calculated whereas in studies determing lateral and central bone biopsies the mean was calculated For statistical analysis the data were weighted according to the number of ... J Oral Maxillofac Implants 2005, 20(3):371-381 Imbronito AV, Scarano A, Orsini G, Piattelli A, Arana-Chavez VE: Ultrastructure of bone healing in defects grafted with a copolymer of polylactic/polyglycolic...

Ngày tải lên: 11/08/2014, 20:20

... 36:1001-1010 Maas AIR, Dearden M, Teasdale GM, Braakman R, Cohadon F, Iannoti F, Karimi A, Lapierre F, Murray G, Ohman J, et al.: EBIC guidelines for management of severe head injury in adults Acta Neurichir ... of AEs, SAEs, TE events, ventilator-free days, and intensive care unit (ICU)-free days were evaluated over the study period of 30 days Statistical analyses Data are expressed as mean ± standard ... hemodynamic stability are of even greater importance in hemodynamically unstable patients with TBI In addition, rFVIIa may prevent the expansion of traumatic intracerebral hemorrhage (ICH) in a manner...

Ngày tải lên: 13/08/2014, 08:20

... direct and maternal effects on the other hand A simple example of that is the classical animal model In (a2 ! ) x! p + +pi, for the jth performance of the ith female (eg ovulation rate of an ewe) as ... that the main advantage of [15] is to provide estimates ofp which can be computed in a similar way as with mixed model equations of Henderson (1984) These equations also imply as a by-product an ... ordered categorical data with a threshold model Genet Sel Evol 15, 201-224 Gilmour A, Anderson RD, Rae A (1985) The analysis of binomial data by a generalized linear mixed model Biometrika 72, 593-599...

Ngày tải lên: 14/08/2014, 19:22

... Africa Western Ghats, India Kinabalu National Park, Borneo Riviere Bleue, New Caledonia Barro Colorado Island, Panama Barro Colorado Island, Panama Atherton Tablelands, Australia Kununurra, Australia ... Australia Vicosa, Brazil Mkomazi Game Reserve, Tanzania Popondetta, Papua New Guinea Sarapiqui, Costa Rica Catanduanes Island, The Philippines Dimona and Porto Alegre, Brazil Lambir Hills National Park, ... and disturbance (Andersen, 1995) The basis of classification was the observation that ants and vascular plants have ecological parallels (Andersen, 1991) Vascular plants generally have similar...

Ngày tải lên: 29/09/2015, 13:01

... the average usage behaviour of accounts from the transaction data and the market interest rates that prevail 16 S Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour Analysis of ... having bank accounts already While almost all other banks reported the percentage of households already having a bank ac- 20 S Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour Analysis ... Chidambaram Semi urban 1086 31 Lakshmi Vilas Bank Bhuvanagiri Semi urban 537 31 Pallavan Grama Bank Sethiathope Rural 1014 40 Pallavan Grama Bank Cuddalore Urban 935 51 SBI Chidambaram Semi urban...

Ngày tải lên: 16/02/2014, 11:20

... ligand had a cooperative character It leads to higher uorescent response and better xation of CBC Final stabilization of IF30CBCIF20 can occur after series of transitions at the domaindomain ... detecting chip (Fig 6) All the above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding ... corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ẳ jACNCbl AH2 OCbl j stands for maximal poss352 ible change in the amplitude at wavelength,...

Ngày tải lên: 19/02/2014, 05:20

... uncertainty analyses and make available a presentation of the uncertainty analysis that would be clear and transparent to decisionmakers and to other interested readers Analysis of benefits for EPA ... Air Quality Planning and Standards www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf ——— 200 9a Proposed NO2 NAAQS Regulatory Impact Analysis (RIA) Research Triangle Park, NC: Office of Air Quality ... Regulatory Impact Analysis, March 2008 National Ambient Air Quality Standards for Ground-level Ozone, Chapter Research Triangle Park, NC: Office of Air Quality Planning and Standards www.epa.gov/ttn/ecas/regdata/RIAs/6ozoneriachapter6.pdf...

Ngày tải lên: 06/03/2014, 19:20

... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... the case analysis 4.2 Algorithm Given an input phrase N1 no N2, b o t h D B A and SBA are applied to the input, and then the two analyses are integrated 4.2.1 Dictionary-based Analysis Dictionary ... IPA Lexicon of Basic Japanese Nouns Japan Electronic Dictionary Research Institute Ltd 1995 EDR Electronic Dictionary Specifications Guide Sadao Kurohashi and Makoto Nagao 1994 A syntactic analysis...

Ngày tải lên: 08/03/2014, 06:20

... reviewers for their feedback on earlier versions of the paper Availability Relevant software and data is available at http:// ertos.nicta.com.au/software/ References [1] A NDRIOD ON F REERUNNER ... detailed analysis and breakdown of its power consumption This is not possible to the same degree on a typical commercial device We have compared the detailed measurements with a coarse-grained analysis ... on Performance Analysis of Systems and Software (San Jose, CA, USA, Apr 25–27 2007), IEEE Computer Society, pp 158–168 [3] B IRCHER , W L., AND J OHN , L K Analysis of dynamic power management...

Ngày tải lên: 23/03/2014, 13:20

... C-PAM + AKD after machine screen 40sec Drainage 60sec Agitator setting High shear Medium shear Low shear A- PAM after machine screen (*) Tested at Mütec DFS retention analyzer Result of laboratory ... Chord for CPAM and AKD Ü Installation in October, 2008 Conclusion of installation in PM7 for CPAM & AKD ÜResults: PM7, additive savings after flash injection installed also for CPAM and AKD Filler ... Technologies Ltd is a Finland based corporation FiberLaboratory City of Savonlinna TrumpJet® Flash Mixing for papermaking additives 17 -Flash mixing takes place in time of two seconds -Transverse injection...

Ngày tải lên: 24/03/2014, 05:20

... collection of the primary and secondary data for the qualitative and quantitative analysis of the various financial ratios of the company 34 Business and Financial Analysis of BP with comparison to Shell ... 3rd Layer Financial Analysis: The above figure depicts the following scorecards analysis of ratios breakeven analysis and various trends 24 Business and Financial Analysis of BP with comparison ... reliability and efficiency of the data depends on the method of the data collected 45 Business and Financial Analysis of BP with comparison to Shell PLC 4.1 2011 Data Analysis The data analysis chapter...

Ngày tải lên: 25/03/2014, 11:06

... proportion of known miRNAs are arranged in clusters For example, 48% of human miRNAs appear as clusters within a maximum inter-miRNA distance of 10 kb [21] and 50% of miRNAs appear as clusters within a ... mechanism of the origin of new plant miRNAs Materials and methods Data sets To obtain the upstream and downstream sequences of plant miRNA genes, we chose four species of plant (A thaliana, P trichocarpa, ... the P value as the fraction of times for which the random averages were smaller (or larger) than the average distances of miRNA pairs to evaluate the statistical significance for clustering patterns...

Ngày tải lên: 28/03/2014, 23:20

... rain FIG Separation of two deamidatcd ribonuclease A variants labclcd as dl-RNase A (isoaspartic acid form) and d2-RNase A (aspartic acid form) by HIC Column, Spherogel HIC-CAA; 10-min linear ... equally applicable to the analysis of enzymatically derived mixtures of peptides and also for the analysis of synthetically derived peptides An example of the high-resolution analysis of a tryptic ... another example of the power of HIC, Fig (page 42) shows the separation of different forms of deamidated ribonuclease A 59 One (dlRNase A) has an isoaspartic acid and the other has an aspartic acid...

Ngày tải lên: 11/04/2014, 09:46

... Genomics 2001, 7(2):97-104 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes Physiol Genomics ... indicating that these genes are generally less reliable for use as normalisers for QPCR assays According to this analysis the most reliable overall reference gene was PP 1A with a sumv value of ... for each infection and a two tailed test with a significance level of 5% was used to measure the significance between sample replicates Repeated measures analysis of variance was then used to test...

Ngày tải lên: 18/06/2014, 18:20

... (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... U -A A-U A- U G G U -A G-C U -A A-U G-C U:G U -A C U C-G U -A GGAAAUG GCCAAGU 337 381 http://www.virologyj.com/content/2/1/12 (-) sense G C A A-U U -A U -A C C A- U C-G A- U U -A C-G A C A- U G A G-C A- U ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family...

Ngày tải lên: 18/06/2014, 22:20

... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently ... increased when lighting is not adequate [12] These changes are reminiscent of the walking pattern of older adults with a HLGD and cautious gait An elevated risk of falling has been associated with ... personal computer for further analysis Subsequently, the digitized data were transferred to a computer workstation for analysis using software that extracts the initial and end contact time of each...

Ngày tải lên: 19/06/2014, 10:20