... also console application; specific programs action, adding, 25–27 breaking, CD132–CD135 building and running, 18–20 console, creating, 29–31 converting class into, CD114–CD115 creating, 15 description ... 196 responding to, CD21–CD22 throwing, CD17–CD19 Exception class creating own, CD13–CD15 overriding, CD22–CD26 exception mechanism example of, CD10–CD13 overview of, CD9–CD10 exclamation point (!) operator, ... upchuck, 153 program. See also console application; specific programs action, adding, 25–27 breaking, CD132–CD135 building and running, 18–20 console, creating, 29–31 converting class into, CD114–CD115 creating,...
Ngày tải lên: 04/10/2013, 21:20
Tài liệu Debugging C and C++ code in a Unix environment ppt
... of Contents Abstract 5 1. Introduction 6 2. Conventions 7 3. Aspects of debugging C and C ++ code 8 Noticing and localising a bug 8 Understanding a bug 8 Repairing a bug 8 Types of bugs 9 C and ... example in the previous section. Another tool is Checker. The Checker tool uses it’s own version of gcc, checkergcc to include boundary checks in your code. It is probably better than Electric Fence, ... a piece of code that can be studied without executing that code. Static analysis can help in detecting a number of basic semantic problems such as type mismatches and dead code. For gcc (the GNU C...
Ngày tải lên: 21/01/2014, 06:20
Secure Coding in C and C++ pdf
... paired. 34 Dueling Containers in C+ + vector<Shape *> pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( new Square ); … list<Shape *> picture; picture.push_back( pic[2] ... C+ +, standard containers that contain pointers do not delete the objects to which the pointers refer. vector<Shape *> pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( ... twice. This problem can also happen when a chunk of memory is freed as a result of error processing but then freed again in the normal course of events. 32 Leaking Containers in C+ + In C+ +,...
Ngày tải lên: 08/03/2014, 11:20
Programming Embedded Systems in C and C ++ docx
... Serial Controller 149 Chapter 10. Optimizing Your Code 151 10.1 Increasing Code Efficiency 151 10.2 Decreasing Code Size 154 10.3 Reducing Memory Usage 156 10.4 Limiting the Impact of C+ + 157 ... The hardware-specific constant CYCLES_PER_MS represents the number of decrement -and- test cycles (nCycles != 0) that the processor can perform in a single millisecond. To determine this number ... of Chapter 6 through Chapter 10 and discusses advanced topics that are of interest to inexperienced and experienced embedded programmers alike. These chapters are mostly self-contained and can...
Ngày tải lên: 17/03/2014, 13:20
Jim ledin embedded control systems in c and c++ an introduction for software developers using MATLAB 2004
... methods Implementing and testing discrete-time floating-point and fixed-point controllers in C and C+ + Adding nonlinear features such as limiters to the controller design About the Author Jim Ledin, P.E., ... points in time. I/O Between Discrete-Time Systems and Continuous-Time Systems A class of I/O devices interfaces discrete-time embedded controllers with continuous plants by performing direct conversions ... actuator saturation occurs, the system's response to increasing controller gains becomes nonlinear and could be unacceptable. It is usually preferable to avoid actuator saturation in control...
Ngày tải lên: 19/03/2014, 14:09
in prostate tests psa what is the difference between total psa and free psa
Ngày tải lên: 21/03/2014, 12:19
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt
... diverse intracellular signaling cascades, most of which activate the IkappaB kinase (IKK) com- plex. This crucial component in the NF-jB activation cascade typically consists of two catalytic subunits [24,25], ... transformed into BL21 (DE3) Escherichia coli. strains, and the cells were grown overnight in 10 mL LB medium containing 100 lgÆmL )1 ampicillin. A colony of E. coli .in LB agar plates was inoculated into ... data description, drug discovery, genetic engineer- ing or scienti c discovery) with its focus on elucidating system mechanisms, has become critical for progress in biology [1–5]. Detailed computational...
Ngày tải lên: 16/03/2014, 11:20
Developing and Porting C and C++ Applications on Aix pdf
... Relationship between a process and a user thread . . . . . . . . . . . . 276 xii Developing and Porting C and C+ + Applications on AIX Chapter 1. C and C+ + compilers 23 1.4 Activating the compilers Once ... Mark Changfoot, Paul Pacholski, Rene Matteau Developing and Porting C and C+ + Applications on AIX June 2003 International Technical Support Organization SG24-5674-01 Chapter 1. C and C+ + compilers ... run-time component a. The vacpp group contains installp packages for part of the C+ + compiler only; it requires packages from the vac group. Note: A single package can contain multiple filesets and...
Ngày tải lên: 17/03/2014, 13:20
Secure Programming Cookbook for C and C++: Recipes for Cryptography, Authentication, Input Validation & More pot
Ngày tải lên: 30/03/2014, 03:20
Tài liệu BEGINNING ASP.NET 4.5 in C# and VB doc
... Your Connection Strings in Web.confi g 464 Filtering Data 466 Customizing the Appearance of the Data Controls 472 Confi guring Columns or Fields of Data-bound Controls 473 Updating and Inserting ... UpdateProgress Control 358 The Timer Control 362 Using Web Services and Page Methods in Ajax Websites 363 What Are Web Services? 364 Introducing WCF 364 Calling Services from Client-Side Code 365 Exchanging ... publishes in a variety of print and electronic formats and by print-on-demand. Some material included with stan- dard print versions of this book may not be included in e-books or in print-on-demand....
Ngày tải lên: 15/02/2014, 07:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... questions and show that both a novel C- terminal actin-binding submodule (CABS) containing a novel actin monomer binding verprolin homology 2 C- terminal (VH2 -C) domain and a sec- ond submodule comprising ... life cycle of actin patches in mating yeast. J Cell Sci 114, 1505– 1513. 9 Pelham RJ Jr & Chang F (2001) Role of actin polymer- ization and actin cables in actin-patch movement in Schizosaccharomyces ... analysis of actin cytoskeleton components. The basic elements of the yeast actin cytoskeleton are cortical actin patches and cytoplasmic actin cables. Actin patches are spots whose subcellular dis- tribution...
Ngày tải lên: 18/02/2014, 16:20
Beginning ASP.NET 4: in C# and VB potx
... that Occur in the Data Source Controls 550 Hand-Coding Data Access Code 554 Caching 565 Common Pitfalls with Caching Data 565 Dierent Ways to Cache Data in ASP.NET Web Applications 566 Practical ... deBuGGinG, and traCinG 65ChaPter 18: 5 Exception Handling 656 Dierent Types of Errors 656 Catching and Handling Exceptions 658 Global Error Handling and Custom Error Pages 666 The Basics of ... 4, including .NET charting and ASP.NET charting, ASP.NET dynamic data and jQuery, and F#. The coverage is divided into six distinctive parts for easy navigation and offers a practical approach...
Ngày tải lên: 05/03/2014, 22:20
RAN D OM WALK IN RANDOM AND NO N- RAND OM ENVIRONMENTS h E C D N D E D I T I O N pdf
... of Csaki 6 Wiener Process and Invariance Principle 6.1 Four lemmas 6.2 Joining of independent random walks 6.3 Definition of the Wiener process 6.4 Invariance Principle 7 Increments ... (mod 2) which proves (2.5). (2.6) can be obtained by a direct calculation. (2.9) Chapter 5 Levy Classes 5.1 Definitions The LIL of Khinchine tells us exactly (in certain sense) how ... n and (ii) S, 2 (1 - c) b;' i.0. a.s. Having in mind this form of the LIL, Levy asked how the class of those functions (or monotone increasing functions) f(n) can be characterized...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx
... due in part to the difference in N-glycosylation of AChE and BChE, which carry four and nine N-glycan chains, respectively [35]; we therefore compared the oligomeric patterns of wild-type BChE and ... both the catalytic domain and the C- terminal t peptides contribute to the control of oligomerization and secretion, in a complex interplay. Origin and significance of the difference between the ... PRAD-containing protein or peptide, in agreement with the recent discovery that human plasma BChE contains a proline-rich peptide from lamellipodin [14]. In conclusion, the catalytic domains of cholinesterases and...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... TTTGATGCAGGTGTTTGAGG reverse, CCACCTGTAGGTCTGGCA Sqstm1 forward, CCTTGCCCTACAGCTGAGTC reverse, CTTGTCTTCTGTGCCTGTGC Ifrd1 forward, GTTTGAATTGGCCAGAGGAA reverse, TCTGTTGGAAAATCCCGTTC Cxcl10 forward, CCCACGTGTTGAGATCATTG reverse, ... CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA Egr1 forward, CCTATGAGCACCTGACCACA reverse, AGGCCACTGACTAGGCTGAA Egr1 pre-mRNA forward, GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA Ndrg1 forward, ... GAGGAACAGCAGAGAGCCTC Cxcl10 pre-mRNA forward, AGCAGAGGAAAATGCACCAG reverse, CACCTGGGTAAAGGGGAGTGA Dusp16 forward, GCTCCGCCACTATTGCTATT reverse, AGGTGCAGCAGCTTCAGTTT Dusp16 pre-mRNA forward, CAGTGCTGGAATTGTACGTGA reverse,...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx
... designed: 5¢-TGAGATGTGCCAGCTGAGGTTCA-3¢ for I282Q (forward), 5¢-CAACGCCCAGCATACCCAGCAGT-3¢ for Q404H (forward), 5¢-CAACGCCCAGGCAACCCAG CAGT-3¢ for Q404A (forward), 5¢-TGAACCTCAGCT GGCACATCTA-3¢ for I282Q ... 5¢-TCGAGCTGTGTATACTGAGATTCA-3¢ for Q285I, 5¢-TCAATGCTCAGCAGACCCAGCGGC-3¢ for H407Q, 5¢-TCAATGCTCAGGCCACCCAGCG GC-3¢ for H407A. The selection restriction site mutation was created by primer 5¢-GTAGCTGACTGGAGCATG CAT-3¢ ... to reflect species speci c differences in CYP3A gene induction. For example, the antibiotic compound rifampicin induces human and rabbit, but not rodent CYP3A. It is also a ligand and activator...
Ngày tải lên: 08/03/2014, 16:20
Quantification of vitamin e and ç oryzanol components in RiceGermandBran
... rapid and direct on-line identification and quantification of the vitamin E and γ-oryzanol components in rice bran and germ. KEYWORDS: Rice bran; rice germ; γ-oryzanol; vitamin E; LC-MS/MS INTRODUCTION Free ... spectrum of 7a could not be obtained in LC − MS/MS analysis because of its very low concentration in the dichloromethane fraction. Quantification of Vitamin E and γ -Oryzanol Components in Rice ... bran without intact germ; ESI-MS, electrospray ionization mass spectrom- etry; API-ES, atmospheric pressure interface-electrospray; ICC, ion-charge control; CID, collision-induced dissociation; frag,...
Ngày tải lên: 15/03/2014, 15:33
Bạn có muốn tìm thêm với từ khóa: