development of a risk management program
Báo cáo y học: "Cost-effectiveness of a hypertension management programme in an elderly population: a Markov model" ppt
... 4,035.36 NA NA NA Software development 11,588.72 NA NA NA Server 3,397.26 NA NA NA Computer 374.83 NA NA NA Software subtotal 73,127.78 NA Software subtotal per patient Programme total 2.44 440,850.89 ... patients is a standard practice Additional material Additional file 1: Table S1 - Basal characteristics of patients in original effectiveness study Table showing basal clinical characteristics of the ... hand, according to their basal cardiovascular risk They could have an acute cardiovascular event or not or die from causes other than cardiovascular ones Survival probabilities for an acute cardiovascular...
- 11
- 285
- 0
báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx
... recruit a total number of 200 participating patients Insurance claims data analysis Sampling of patients As case finding is crucial for effective care management we will take two different approaches ... as well as care organization contributes to avoidable hospitalizations and to what extent care management may be able to implement strategies that target the revealed mechanisms As implementation ... healthcare assistants as valuable improvement of chronic care [24-26] Whereas international research on care management has mainly focused on nurse-led programs, evidence about the potential role of...
- 7
- 335
- 0
Báo cáo y học: " ALGOS: the development of a randomized controlled trial testing a case management algorithm designed to reduce suicide risk among suicide attempters" potx
... consisted of a postcard sent to participants in a sealed envelope at 1, 2, 3, 4, 6, 8, 10, and 12 months after discharge (a total of postcards) The message was the same for all postcards: «It has been ... behaviours at the six months follow-up ALGOS algorithm would be more a «crisis management plan», rather than a «case management plan» The main objective is to evaluate the effectiveness of the algorithm ... kind of study, the data may be biased by an excessive number of patients included and lost of contact To limit this bias and improve the data quality, the participants remained lost of contact...
- 7
- 287
- 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human...
- 30
- 369
- 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
... below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence measures were created specifically ... commencement of treatment One-year prevalence rates of SA range from 2.9% to 11% [4,6,7] Longer term follow-up studies have reported a 2-year prevalence rate of 11.3% [8] and a 4year prevalence rate of ... training in managing clinical aggression, Mental Health First Aid Training [24] and suicide risk management training (Applied Suicide Intervention Skills Training (ASIST)) [25] In addition a...
- 7
- 443
- 0
Báo cáo y học: " Study protocol: the development of a randomised controlled trial testing a postcard intervention designed to reduce suicide risk among young help-seekers" ppsx
... baseline values of an outcome measure as the covariate It is assumed (conservatively) that the covariate would explain 5% of the variance in the dependent variable Based on previous research at ... substantial Safety and supervision The research assistant received training in the administration of the measures and in the assessment of suicide risk The research assistant will make contact ... depression - A comparison of depression scales J Am Acad Child, Adolesc Psychiatry 1991, 30(1):58-66 Beck AT, Steer RA: Beck Scale for Suicidal Ideation: Manual San Antonio: The Psychological Corporation;...
- 6
- 492
- 0
Báo cáo y học: "andidemia on presentation to the hospital: development and validation of a risk score" pptx
... cohort (Table 2) [see Additional data file 2] Derivation and validation of candidemia risk score Univariate analysis revealed that the following variables were associated with candidemia: age younger ... receive early and appropriate antifungal therapy, underscores the anticipated benefit of easy-to-use risk stratification Prior efforts at risk stratification for candidemia as a cause of nosocomial ... presentation on admission as candidate variables, which is likely to be a strength of our paper because many large-scale databases tend to only have the results of administrative coding and lack actual culture...
- 10
- 394
- 0
Building a risk management system at Ho Chi Minh City investment fund for urban development (HIFU)
... shortfall originated from the current status of the Fund that is lack of basic factors of a standard model of market risk management as below: Lack of a measuring model of market risk including a ... must deal with Generally, enterprise risk management is so-called a tool which enables management to identify, assess and manage risks in the face of uncertainty Similarly, risk management is a general ... a general management function that seeks to assess and address the causes and effects of uncertainty and risk on an organization The purpose of risk management is to enable an organization to...
- 91
- 326
- 0
development of a simplified concept for process benchmarking of urban wastewater management xây dựng một phương pháp đơn giản cho benchmarking ngành quản lý nước thải đô thị
... of wastewater management system and (4) current situation of urban wastewater management in Vietnam 1.1 Characteristics of Urban Wastewater 1.1.1 What is Urban Wastewater? According to Tchobanoglous ... Maturation (tertiary) lagoons Facultative lagoons Facultative lagoons Anaerobic lagoons Anaerobic lagoons Carbonaceous BOD removal, nitrification Carbonaceous BOD removal Carbonaceous BOD removal, ... (Lindtner et al., 2008) Data quality assessment is achieved by means of plausibility check to ensure that data meet a feasible range Financial data is checked by variance analysis in which the data is...
- 115
- 825
- 0
DEVELOPMENT OF a SIMPLIFIED CONCEPT FOR PROCESS BENCHMARKING OF URBAN WASTEWATER MANAGEMENT
... of wastewater management system and (4) current situation of urban wastewater management in Vietnam 1.1 Characteristics of Urban Wastewater 1.1.1 What is Urban Wastewater? According to Tchobanoglous ... Maturation lagoons Maturation (tertiary) lagoons Carbonaceous BOD removal Facultative lagoons Facultative lagoons Carbonaceous BOD removal, waste stabilization Anaerobic lagoons Anaerobic lagoons ... Composition of Wastewater The analysis of wastewater data involves the determination of the flowrate and mass loading variations From the standpoint of treatment processes, average flowrates and average...
- 115
- 289
- 0
Development of a method to measure consumer emotions associated with foods
... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that...
- 10
- 781
- 3
Tài liệu Tips and tricks gleaned from UGA’s Foundations of Leadership and Management Program doc
... size of the room Keep practicing until the ‘professional you’ and the ‘personal you’ are the same person Use verbal and non-verbal approaches that capture attention Always use body language ... are physically close to the audience Presenting Before a Group Getting Comfortable Animate your facial expressions in a way that is natural and appropriate to your speech Avoid a ... gathered around a central speaker and attach yourself to it c.Stand on the fringe of the crowd and observe d.Look for a small group – or persons – and join it 12 It is okay to use all uppercase characters...
- 24
- 480
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... of knowledge creation in organizations Working paper, University of New South Wales, Australia Teece D, Pisano G, Shuen A 1997 The dynamic capabilities and strategic management Strategic Management ... shared learning in selfmanagement teams F J Forcadell and F Guadamillas Knowledge and Process Management * Autonomy for taking decisions and tolerance of the mistakes which application of new ... levels and organization of the work into teams Irizar has a very flexible organization, with a very low number of levels and an almost flat organization chart There are no intermediate supervisors and...
- 10
- 1,063
- 1
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... cells may cause a dysfunctional cardiac flow and cause the sudden death of the transgenic mice, although it remains to be determined whether T antigen-expressing cardiac valves are functionally affected...
- 11
- 873
- 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation Acknowledgements: This work is supported by the Natural ... Research Program of VNU (QG-04) and the National Basic Science Research Program of Vietnam References Nguyen The Binh, Surface probe by second harmonic generation, Advances in Photonics and Applications,...
- 6
- 524
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...
- 88
- 581
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA...
- 14
- 473
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... computational meshes obtained is acceptable These generated meshes have been used as the input of a 3D computational fluid dynamics software for turbulent compressible atmospheric flows and air quality...
- 14
- 402
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least three ... PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco plants, which had been sprayed ... (lower panel) Mean values ± standard error of at least three replicates are presented (B) The EPR measurements indicated that the leaves pretreated with ABA had a higher OH• level after ParA1 treatment...
- 15
- 479
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25