... appliances In contrast to typed command labels, text-based interfaces or text navigation, a GUI has established a model containing the information and actions, and also supplied availabilities of ... and IBM Presentation Manager All these ideas were indicated a fact that current versions of user interface such as Microsoft Windows and Mac OS X were invented as a result of evaluations However, ... future similar systems can be based on Experiments on drop impact dynamics, optimization of material printing parameters and fabrication of multiple material capacitors on various substrates will...
Ngày tải lên: 04/10/2015, 15:46
... Chapter Graphical user interface The goal of the graphical user interface design is to create an appropriate environment as a superstructure above the ABOS method implementation satisfying ... solved as a stand-alone utility VOLUME 4.1 Project manager SurGe Project Manager (SPM) is a simple application, which enables: - to manage projects and maps in an easy and comfortable way (create a ... requirements: management of projects transformation of map objects coordinates specification of interpolation parameters and running SURGEF.EXE 2D and 3D display of surfaces, computation and display of isolines...
Ngày tải lên: 21/01/2014, 07:20
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... “Modeling and application of elastomer mesh for microwave probing,” IEE proceedings on Microwaves, Antennas and Propagation, Vol.153, No 1, pp.83-88, Feb 2006 J Jayabalan, R Jayaganthan, A. A.O Andrew ... availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite lattice ... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI-GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore...
Ngày tải lên: 11/09/2015, 14:24
Development of a method to measure consumer emotions associated with foods
... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that...
Ngày tải lên: 03/04/2013, 21:07
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of IMP have been identified in APEC Management...
Ngày tải lên: 28/10/2013, 11:15
Tài liệu Creating Graphical User Interfaces Matlab 7.0 doc
... Trademarks MATLAB and Simulink are registered trademarks of The MathWorks, Inc See www.mathworks.com/trademarks for a list of additional trademarks Other product or brand names may be trademarks ... a GUI? A graphical user interface (GUI) is a graphical display in one or more windows containing controls, called components, that enable a user to perform interactive tasks The user of the GUI ... Sharing Data Among a GUI’s Callbacks Sharing Data with Nested Functions Sharing Data with UserData Sharing Data with Application Data ...
Ngày tải lên: 13/12/2013, 06:15
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... cells may cause a dysfunctional cardiac flow and cause the sudden death of the transgenic mice, although it remains to be determined whether T antigen-expressing cardiac valves are functionally affected...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... Intelligence in Education, 16 C Rich and C L Sidner 1998 COLLAGEN: A Collaboration Manager for Software Interface Agents User Modeling and User- Adapted Interaction, 8(3-4) M Rotaru and D Litman 2006 Exploiting ... for Spoken Dialogue Performance Analysis In Proc of EMNLP M Walker, D Litman, C Kamm and A Abella 2000 Towards Developing General Models of Usability with PARADISE Natural Language Engineering ... is not always available and users have to activate it manually Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g talking heads (Graesser et al., 2003))...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation Acknowledgements: This work is supported by the Natural ... overlaps Raman spectrum This was proved very clearly in the Raman spectra of the petrol extract sample 5B110 and 5B11 (petrol extracts from Bach Ho, Vietnam) The Raman spectra excited by He-Ne laser...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... computational meshes obtained is acceptable These generated meshes have been used as the input of a 3D computational fluid dynamics software for turbulent compressible atmospheric flows and air quality...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least three ... PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco plants, which had been sprayed ... (lower panel) Mean values ± standard error of at least three replicates are presented (B) The EPR measurements indicated that the leaves pretreated with ABA had a higher OH• level after ParA1 treatment...
Ngày tải lên: 15/03/2014, 00:20
Development of a DTPA soil test for zinc, iron, manganese, and cropper
Ngày tải lên: 15/03/2014, 23:56
Development of a simple
... scheme, and allows the assessment of the contribution of biogeochemically available trace metals to the total particulate metal concentration in SPM Materials and methods 2.1 Reagents and labware All ... was calculated as: Percentage OC 100 A B A (1) 2.3 Use of EDTA as extractant The interaction between an added chelating ligand and metals complexed by naturally occurring ligands in the aquatic ... Whitworth et al / Analytica Chimica Acta 392 (1999) 3±17 mation about the biogeochemical availability of the particulate matter associated trace metals For soils and sediments, workers have employed...
Ngày tải lên: 15/03/2014, 23:56
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf
... discussion of this specific problem and of this report as a whole DEVELOPMENT OF A STEMMING ALGORITHM After a word in the library user' s query has been stemmed and a matching stem and associated list of ... Semantic Organization of Scientific Terms." Information Storage and Retrieval (April 1967), pp 35-115 Earl, Lois L "Part -of- Speech Implications of Affixes." Mechanical Translation and Computational ... associating related items of information, as they are in an automated library catalogue, and where the catalogue can be interrogated in an on-line mode, it seems best to use a strong algorithm, that is,...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the ... Furutani Y, Kato A, Notoya M, Ghoneim MA & Hirose S (2001) A simple assay and histochemical localization of transglutaminase activity using a derivative of green fluorescent protein as substrate...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... 1269–1272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W of...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt
... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... Harper Parsec: An architecture for parallel parsing of constraint dependency grammars In Submitted to The Proceedings o/the ~9th Annual Meeting o.f ACL, June 1991 [3] H Maruyama Constraint dependency...
Ngày tải lên: 23/03/2014, 20:20
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx
... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced ... interaction between GnRH-R molecules The effect of a GnRH agonist and antagonist on GnRHR association has also been examined The data showed that FRET was enhanced by the addition of a GnRH agonist...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... stored at )70 °C until assayed with a RIA (radioimmunoassay) kit (Amersham, Little Chalfont) Data analysis was achieved with the sigmoidal dose–response curve fitting program ALLFIT Statistical significance ... to SDS/PAGE Autoradiography was carried out on a BAS-IP NP 2040P imaging plate Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt) Gel documentation was accomplished ... difference was not statistically significant The photoactivatable antisauvagine-30 analog was shown to be as potent as its parent peptide when stimulating cAMP accumulation alone or suppressing agonist-induced...
Ngày tải lên: 31/03/2014, 08:20