... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...
... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants ... terminal cardiac puncture Data for panels B-F are expressed as the average of values from four to five mice/timepoint and error bars indicate the standard deviation and this explains the low WBC and ... To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage...
... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants ... terminal cardiac puncture Data for panels B-F are expressed as the average of values from four to five mice/timepoint and error bars indicate the standard deviation and this explains the low WBC and ... To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage...
... testbed and the realization of WUSN experiments are challenging This work provides a set of guidelines that result in a balanced approach between high accuracy and a practical implementation ofa WUSN ... 29 30 the explanation in this section also applies to other types of antenna polarization The original antenna ofa Mica2 mote is a standard onequarter wavelength monopole antenna with 17 cm-length ... presented and aspects such as physical layout and software are discussed The use of paper and plastic pipes are considered in detail, explaining the advantages of these devices in the process of burying...
... degradation Additional data file contains the original data used to perform this analysis and is available with the online version of this paper interactions Additional data files refereed research ... Ben-Neriah Y, Baeuuerle PA: Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B Nature 1993, 365:182-185 Beg AA, Finco TS, Nantermet PV, Baldwin AS Jr: ... cultured and used for plasmid preparation We transfected these 12 groups of plasmid DNA into 293T cells and again subjected them to FACS analysis and gating as before The EGFP-C1 vector was used as a...
... (lateral collateral ligament and medial collateral ligament), and two interior ligaments (anterior cruciate ligament (ACL) and posterior cruciate ligament), which help control stabilisation and ... torsional strain alone acts to translate individual fibers organised in a helical geometry, translational strains are needed to control fiber pitch angle and mimic anterior draw loads typically stabilised ... be a promising alternative in using cell transplantation as a strategy to achieve tissue repair and regeneration fora variety of therapeutic needs One approach involves use of three-dimensional...
... and Structural Stiffness for each groups (mean ± SD) 101 Table G-1 Alamar Blue reading and % reduction calculation for Day 132 Table G – Alamar Blue reading and % reduction calculation for Day ... After that, all bioreactors parts are assembled inside a biological safety cabinet The basic straining mechanism of bioreactors for tubular form scaffolds and sheet form scaffolds are the same One ... each orientation angle for all sample groups 39 Table 4.1 Physical properties of various suitable plastics; (· · mean steam Autoclavable, X mean not autoclavable) [extracted from www.nuncbrand.com]...
... of and ability to use navigational charts and publications, …” Criteria for evaluating competency are stated as “The charts selected are the largest scale suitable for the area of navigation and ... ensure appropriate selection EXPLAIN ALL SAFETY-RELEVANT AS WELL AS OTHER MAJOR CHARACTERISTICS OF ECDIS DATA SUCH AS DATA CONTENTS, HANDLE ECDIS DATA ON BOARD AND ASSESS ALL ERRORS, INACCURACIES AND ... Criteria for evaluating competency are stated as “The charts selected are the largest scale suitable for the area of navigation and charts and publications are corrected in accordance with the latest...
... [19] Hasnain, S.M., Alawaji, S.H., A1 -Ibrahim, A and Smiai, M.S (1999), Application of Thermal Energy Storage in Saudi Arabia International Journal of Energy Research, vol 23, pp 117-124 [20] Zaheer-uddin, ... was created to simulate the temperature of the exterior wall of the room This temperature curve simulated the exterior surface and was assumed to be at a constant value of 320K A 3-D Cartesian ... E-mail address: lizc0451@gmail.com Ramesh K Agarwal received his PhD in aeronautical sciences from Stanford University in 1975 His research interests are in the theory and applications of Computational...
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations fora Risk Management ... and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of IMP have been identified in APEC Management...
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... close to the real area has to be greater than that afar Fig 21 The 3D computational domain surrounding a real 3D topography 104 D.N Hai, N.T Thang / VNU Journal of Science, Mathematics - Physics...
... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the gene for ... Institute of Technology, Japan) for providing guinea pig liver TGase 2, Dr T Yoshimura (Graduate School of Bioagricultural Sciences, Nagoya University, Japan) for technical advice on analysis of the...
... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced ... CA, USA) as a template PCR was carried out as described above using the forward primer (5¢-AATTCTGCAGTCGACGGT AC-3¢) and the reverse primer (5¢-GATTATGAATTCG AGTCGCGGCCGCTTTACTT-3¢) An EcoRI site...
... L .A. , Rivier, J.E & Vale, W.W (1999) Comparison of an agonist, urocortin, and an antagonist, astressin, as radioligands for characterization of corticotropin-releasing factor receptors J Pharmacol ... to SDS/PAGE Autoradiography was carried out on a BAS-IP NP 2040P imaging plate Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt) Gel documentation was accomplished ... difference was not statistically significant The photoactivatable antisauvagine-30 analog was shown to be as potent as its parent peptide when stimulating cAMP accumulation alone or suppressing agonist-induced...
... peritoneal cavity is a common site of ovarian cancer presentation or recurrence usually accompanied by ascites [3] Massive ascites and the associated abdominal distention can cause anorexia, nausea, ... the developmentof DNAbased therapy for human ovarian cancer related ascites The successful developmentof anti-tumor gene therapy depends on the use ofa combinatorial approach aimed at targeted ... coordination, data interpretation, performed the statistical analysis, and drafted the manuscript AC participated in the study design and coordination TL participated in the analyses of the ovarian...
... determined and the mean of the total areas was calculated for each group The Mean and SD of bladder tumor area (A) and weight (B) are shown Amit and Hochberg Journal of Translational Medicine 2010, ... area of the malignant tissue of each bladder was determined by ImagePro Plus software Another healthy mice were used as control The total tumor area of each bladder was determined and the mean ... activation was reported as a major mechanism for the IGF2 overexpression in a variety of tumors including bladder carcinoma, hepatocellular carcinoma, breast cancer, ovarian cancer and prostate cancer...
... Carleton BC: Overview of health-related quality -of- life measures for pediatric patients: application in the assessment of pharmacotherapeutic and pharmacoeconomic outcomes Pharmacotherapy 1996, 16(5):879-888 ... information regarding a patient's HRQL may be a useful source of information provided that additional information is available to support the validity of the proxy ratings [16] Even when a child's ... methodological support throughout and was involved in writing the manuscript PU was the primary researcher, was responsible for co-ordinating and managing the study on a day-to-day basis, for data collection...