... this is not possible and a delay of several weeks occurs between results, misclassification is unlikely, as TB is a chronic disease and little change in disease status is expected during this time) ... analysis and data synthesis The first step in data analysis will be a descriptive analysis of the results of the primary studies For both review question A and review question B, the results will ... analysis, or manuscript production Study addresses question A (detection of MTB) and/ or B (detec- - A tion of RIF resistance)? 2-B - A and B What was the purpose of this study? * if smear results...
Ngày tải lên: 06/03/2014, 04:20
... Arabidopsis Genome Initiative figures the distribution of class I, II and Basho transposons in A thaliana chromosomes Class I retrotransposons are less abundant in A thaliana than in other plants and ... calculated and the result shows that the gene density in AT-isochores is lower than that of GC-isochores, which is consistent with the results of [17] Other h-values can also be chosen as the threshold ... whole chromosome The results for other isochores and chromosomes are listed in supplementary Tables S1 and S2 Table shows that the genes in NOR prefer amino acids encoded by GC-rich codons and GC-ending...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: " Improved Automatic Detection of Zero Subjects and Impersonal Constructions in Spanish" docx
... errors per class (Table 8) we take into account the following four classes of errors for the analysis: (a) impersonal constructions classified as zero subjects, (b) impersonal constructions classified ... classified as explicit subjects, (c) zero subjects classified as explicit subjects, and (d) explicit subjects classified as zero subjects The diagonal numbers are the true predicted cases The classification ... 2: Instances per class in ESZIC Corpus To measure inter-annotator reliability we use Fleiss’ Kappa statistical measure (Fleiss, 1971) We extracted 10% of the instances of each of the texts of the...
Ngày tải lên: 31/03/2014, 21:20
Báo cáo sinh học: "Concomitant detection of IFNa signature and activated monocyte/dendritic cell precursors in the peripheral blood of IFNa-treated subjects at early times after repeated local cytokine treatments" doc
... pathogenesis of autoimmune diseases, such as Rheumatoid arthritis, SLE and Progressive Systemic Sclerosis in mouse models as well as in humans [38] Moreover, our list included at least genes belonging ... healthy donors and melanoma patients; ii) such response is transient, does not reach a steady-state level of refractoriness and can occur after inoculation of as little as millions of units of IFNa ... expression of BAFF, CXCL-10 and Mx transcripts using an ABI Prism 7900 HT (Applied Biosystems, Foster City, CA, USA) Primers and probes were custom-designed to span exon-intron junctions and generate...
Ngày tải lên: 18/06/2014, 19:20
Unique role of ionic liquid bminBF4 during curcumin–surfactant association and micellization of cationic, anionic and non ionic surfactant solutions
... Variation of Stokes’ shift of curcumin in different concentrations of aqueous CTAB (A), SDS (B) and TX100 (C) in the absence and presence of IL ent trends of Stokes s shift for various surfactants could ... software and data analysis was made using OrginPro 6.0 software Results and discussion 3.1 Curcumin–surfactant interaction in absence of IL Generally, curcumin showed a strong and intense absorption ... from Acros Organics and were dissolved in different volumes of double distilled water for the preparation of several concentrations of surfactant solutions The stock solutions consisted of 10 mM...
Ngày tải lên: 01/07/2014, 13:23
Báo cáo y học: "Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture" doc
... perioperative samples were processed as described previously [6] In brief, samples were disrupted by vigorous agitation with sterile glass beads in sterile diluent Aliquots of the tissue suspension were ... epidermidis (19.6%) and Leifsonia shinshuensis (10.9%) Number of isolates (percentage) Leifsonia aquatica 20 (43.5) Staphylococcus epidermidis (19.6) Leifsonia shinshuensis (10.9) Proteus mirabilis (8.7) ... surface of the prosthetic hip joints are unknown, it is not possible to use specialised media and conditions at this stage, primarily because of cost implications and the time required to process specimens...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Targeted next-generation sequencing of a cancer transcriptome enhances detection of sequence variants and novel fusion transcript" ppt
... expression levels, facilitated the discovery of novel splice variants, and enabled detection of novel fusion transcripts and isoforms thereof that would otherwise have escaped detection As such, ... detection of SNPs (Figure 1), splice isoforms, and fusion transcripts (Table 2) in the targeted transcripts Importantly, this property reduces the amount of sequencing, and consequently costs, ... K-562 RNA-Seq study [11] Understanding the functional significance of these fusion transcripts is beyond the scope of this study, but this work clearly demonstrates the power of targeted RNA-Seq to...
Ngày tải lên: 09/08/2014, 20:20
báo cáo khoa học: "C60-Fullerenes: detection of intracellular photoluminescence and lack of cytotoxic effects" pdf
... effects was confirmed by two different assays (crystal violet staining and live-dead cell assays) and cell cycle analyses The amounts of C60 used in these experiments is comparable to those used ... C60 suspensions were prepared and immediately applied to 12-well tissue culture dishes based on a protocol used for anoikis assays [29,32] Following application of the suspensions, methanol was ... minutes of sample sonication Transmission electron microscopy Transmission electron microscopy was done on fullerene clusters dried from methanol onto formvar grids A Phillips TEM Transmission...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... NTC is the negative control; ND is the non- diluted sample (9.6 × 105); CSFV is classical swine fever virus; SVDV is swine vesicular disease virus; VESV is vesicular exanthema of swine virus; ch-1a ... and quantitation of PRRSV in field samples Materials and methods Virus strain and field samples CH-1a (GenBank access number: AY032626) virus strain, CSFV, SVDV and VESV were preserved at virology ... that of the conventional RT-PCR assay Detection in field specimens To assess the use of the qRT-PCR for the detection of viral RNA in the field, 65 samples were collected as described previously...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: " Detection of NP, N3 and N7 antibodies to avian influenza virus by indirect ELISA using yeast-expressed antigens" pptx
... reports of using yeast expressed AIV recombinant proteins as antigens for ELISA To the best of our knowledge, this is the first report of expressing NP, N3 and N7 proteins of AIV in S cerevisiae and ... proteins In addition, yeast combines the simplicity and costeffectiveness of bacterial expression systems and is better than the more expensive and less convenient cell culture systems [22] To ... GA USA, and Synbiotics, Inc., CA USA) and the rest were positive for Newcastle disease (ND), infectious bursal disease (IBD) and infectious bronchitis (IB) obtained from Synbiotics and Charles...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
... of H5N1 was < 0.5 PFU of virus and 10 copies of ssDNA plasmids No fluorescence was detected when analyzing human seasonal H1N1 (n = 4) and H3N2 (n = 5) virus isolates and non- H5 avian viruses ... [28] The assay was shown to be sensitive, detecting 10 copies of ssDNA plasmid, and less than 0.5 PFU of H5N1 viruses per reaction, and specific for the detection of influenza A of subtype H5 ... Y, Xia NS, Naipospos TS, Yuen KY, Hassan SS, Bahri S, Nguyen TD, Webster RG, Peiris JS, Guan Y: Establishment of multiple sublineages of H5N1 influenza virus in Asia: implications for pandemic...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa
... cells SIV vectors FACS analysis using HIV-1 Gag-Poltransfer to HIV-2 transfer a Quantitative assessment of GFP to package gene and by a Quantitative assessment of GFP transfer to SVC2 cells by ... (GACGTAAACGGCCACAAGTT) and the antisense primer Amplified products were resolved by agarose gel electrophoresis and EtBR staining The transduction efficiency of cross-packaged vectors was assessed by FACS analysis ... Transcriptase was used (Blank = No data) b Quantitative assessment of GFP transfer to SVC2 cells by FACS analysis using SIV Gag-Pol to package gene transfer vectors based on SIV, HIV-1 and HIV-2...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " Multi-faceted, multi-versatile microarray: simultaneous detection of many viruses and their expression profiles" pps
... Figure Schematic drawing of the multivirus-chip that possesses multiple functions Schematic drawing of the multivirus-chip that possesses multiple functions The multi-virus array used in the study ... chromatin-associated proteins and their modifications play vital roles in many physiological processes such as growth, differentiation, and development in mammals, plants and fungi [6,7] Many studies ... clinical disease manifestations Second, the high throughput and flexible synthesis nature of DNA microarray construction can allow scientists to tailor-make and rapidly alter arrays to match...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Segmentation-based detection of allelic imbalance and loss-of-heterozygosity in cancer cells using whole genome SNP arrays" ppsx
... imbalance Results and discussion This study is outlined as follows with results and discussion presented accordingly First we demonstrate that segmentation methods used in DNA copy number analysis can ... heterozygous SNPs, a band at for SNPs genotyped as AA and a band at for SNPs genotyped as BB Allelic imbalances in tumor samples are observed in BAF plots as a deviation from 0.5 of SNPs heterozygous ... on the basis of their segmented mBAF values Evaluation and comparison of sensitivity and specificity using simulated Illumina data To investigate the sensitivity and specificity of the segmentation...
Ngày tải lên: 14/08/2014, 20:22
gul et al - 2007 - auditor independence - evidence on the joint effects of auditor tenure and non-audit fees
... descriptive statistics for the sub-sample of positive discretionary accruals Regression Results First, we conduct an OLS regression test on the total sample using the log of absolute value of REDCA as ... between non- audit fees and positive discretionary accruals, we conduct tests on the sub-samples of small and large clients firms separately We use the median asset size to split the sample into subgroups ... results suggest that the association between non- audit fees and positive discretionary accruals is positive and significant when auditor tenure is short, and there is no association between non- audit...
Ngày tải lên: 06/01/2015, 19:42
Development of gold nanoparticle DNA nanostructure assembly for detection of DNA, RNA and protein biomarkers
... longer and more massive 100-base single strand DNA (ssDNA) With shorter ssDNA, such as 18b ssDNA, the distinct bands were not observed Instead, the conjugates showed a smear on the agarose gel, ... studies, serum samples were successfully tested, and the potential of developing a rapid test system capable of point -of- care use was apparent In the system proposed by Huo and coworkers, AuNPs was ... diagnostics The understanding of AuNPs ranges from the controlled synthesis of AuNPs of different size, shapes and structures, to their functionalizations with different ligands The ligands can enhance...
Ngày tải lên: 09/09/2015, 11:16
Analysis and detection of human emotion and stress from speech signals
... List of feature statistics 61 4.2 Data set sizes of individual speaker of emotion database (ESMBS) and stress database (SUSAS) 63 4.3 Statistics of the word ‘strafe’ spoken by male speaker (SUSAS) ... feel and what they want to Expression of emotions may be in several forms such as gestures, facial expressions and nonverbal sounds such as sighs, moans and growls Study by Ishii [105] suggests ... cultures In the following section, the previous studies on the analysis and classification of stress and emotion are reviewed 2.4 Reviews of Analysis and Classification Systems of Stress and Emotion...
Ngày tải lên: 15/09/2015, 22:03
The importance of introducing some cultural aspects on stubborness of the british to sophomores of english majors and non english majors at hanoi pedagogical university no 2
... national self-expression” states how the aspects of British society express themselves and the overall view of culture and style of British such as dress code, art, sport, and so on In “Rules, Britannia”,Toni ... majors are better than non- English majors in understanding the cultural aspects on the British s stubbornness This is easily understandable because non- English majors not study so assiduously as ... (mks) Besides, natural units and non- standard units are other kinds of system of measurement Natural units are physical units of measurement defined in terms of universal physical constants in such...
Ngày tải lên: 30/11/2015, 09:14