detection and identification of antibodies

Detection and identification of mean shifts in multivariate autocorrelated processes a comparative study

Detection and identification of mean shifts in multivariate autocorrelated processes a comparative study

... magnitudes of shift in X and Y, various levels of autocorrelation of X and Y, and correlation between X and Y should be investigated The shift sizes in X and Y are set to 0, 0.5, 1, and Further, ... the First -Detection rate of X, Y% is used to represent the First -Detection 37 rate of the variable Y, and XY% is used to represent the First -Detection rate of both X and Y The First -Detection ... shift size of X (δx), mean shift size of Y (δy), autocorrelation of X (φx), autocorrelation of Y (φy) and correlation between the error terms of X and Y (ρxy) The desired outputs, δx and δy, represent...

Ngày tải lên: 04/10/2015, 15:45

125 904 0
báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

... and only minimal presence of Muc16 on the cell surface (Figs 6a–d) Similar results were obtained with both the 618F and 653F antibodies (Fig 6c and 6d) Discussion Figure ting Identification of ... SDS-PAGE and probed with a panel of anti-MUC16 monoclonal antibodies Arrows indicate migration of 250 kDa molecular weight marker and identity of antibody used is shown on the right of each blot ... specificity of 618F and 653F for MUC16 and their ability to recognize Muc16 from the MOVCAR2 spent media, we primarily conducted all of our further experiments with these two antibodies Binding of murine...

Ngày tải lên: 20/06/2014, 07:20

7 430 0
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

... Switzerland) Once suspicious colonies are identified, confirmation of the isolates as E coli O157:H7 is dependent upon biochemical identification and demonstration of the presence of somatic and ... strains), C1-6 (strains of Cornell Univ.) and P1-7 (strains from E coli reference center of Pennsylvania State Univ.) b The presence of Stx1 and Stx2 “-” and “+” indicate negative and positive, respectively ... assessment of the risks difficult, and the options for management and control unclear The objectives of this study are (i) to examine the prevalence of E coli O157:H7 in slaughterhouses and retail...

Ngày tải lên: 07/08/2014, 18:21

13 456 0
Báo cáo khoa học: " Detection and identification by PCR of Clostridium chauvoei in clinical isolates, bovine faeces and substrates from biogas plant" potx

Báo cáo khoa học: " Detection and identification by PCR of Clostridium chauvoei in clinical isolates, bovine faeces and substrates from biogas plant" potx

... standard methods at SVA, which comprise fermentation of glucose, maltose, lactose, sucrose, starch, mannitol and fructose, and production of lecithinase, tryptophanase, urease and hydrolysis of ... Collection of samples from farms Manure, soil and silage Eleven dairy farms (A-K) from the island of Öland of south-east Sweden were included in this study (Table 1) Blackleg is endemic on this island ... standard method for detection of C chauvoei is based on culture and in most muscle samples from cattle dead from blackleg the amount of C chauvoei is high However, this is not always the case and...

Ngày tải lên: 12/08/2014, 18:22

9 347 0
Báo cáo " Analysis and identification of multi-variate random pressure fields using covariance and spectral proper transformations " pdf

Báo cáo " Analysis and identification of multi-variate random pressure fields using covariance and spectral proper transformations " pdf

... physical meaning of the spectral pressure modes as well as the linkage between the pressure modes and hidden events of the unsteady pressure fields Synthesis and identification of random pressure ... ratios of B/D=1 and B/D=5 in the wind tunnel tests Proper orthogonal decomposition 2.1 Definition The POD is optimum approximation of random field The main idea of the POD is to find out a set of ... orthogonal basic vectors which can expand a multi-variate random process into a sum of products of these basic orthogonal vectors and single-variant uncorrelated random processes Let consider the...

Ngày tải lên: 05/03/2014, 14:20

14 390 0
Perspectives of Chief Ethics and Compliance Officers on the Detection and Prevention of Corporate Misdeeds ppt

Perspectives of Chief Ethics and Compliance Officers on the Detection and Prevention of Corporate Misdeeds ppt

... of 2008 has aroused the interest of U.S policymakers in the mechanisms of corporate governance, compliance, and ethics, and their collective role in preventing and mitigating excesses and scandals ... options back-dating scandals and the mutual fund market-timing scandals of the mid-2000s Of course, the most recent set of corporate scandals has broadly swept across the mortgage and banking sectors, ... sector and other parts of the economy It is in this context that RAND convened a March 5, 2009, conference entitled “Perspectives of Chief Ethics and Compliance Officers on the Detection and Prevention...

Ngày tải lên: 06/03/2014, 22:20

61 422 0
Báo cáo khoa học: "Automatic Detection and Correction of Errors in Dependency Treebanks" potx

Báo cáo khoa học: "Automatic Detection and Correction of Errors in Dependency Treebanks" potx

... Automatic Correction of Errors In this section we propose our algorithm for automatic correction of errors, which consists out of the following steps: Automatic detection of error candidates, i.e cases ... results different to gold-standard Substitution of the annotation of the error candidates by the annotation proposed by one of the parsers (in our case MSTParser) Parse of the modified corpus with ... detection and correction of errors and compared it to the only other work we have found in this field Our results show that both approaches are rather complementary and find different types of...

Ngày tải lên: 07/03/2014, 22:20

5 376 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... analysis of metabolites Reactions were initiated by the addition of 100 ll of a solution of enzyme (200 lgÆmL)1) to 0.9 mL of a solution of 50 lg of substrate in 10% (v/v) dimethyl sulfoxide and incubated ... 0.1 mL of EC or CY to 1.0 mL of VM containing 10 lg of GOU For HP and M, reactions were initiated by addition of 0.1 g of HP or M to 1.0 mL of VM containing 10 lg of GOU After incubation for 12 ... reduced and polymerized form of GOU (DHP-GOU) was synthesized as follows Acetone (50 mL) containing 0.2% GOU aO and 0.2% conyferyl alcohol, and 20 mL of 3% H2O2 were dropped into 430 mL of 100...

Ngày tải lên: 17/03/2014, 03:20

10 671 0
Guidelines for the early detection and screening of breast cancer ppt

Guidelines for the early detection and screening of breast cancer ppt

... stages of treatment, the services offered and available, and the course of treatment and recuperation expected As important, is educating the woman and her family in the early detection of any ... goal of screening should be focused on detection of breast cancer at early stages of the disease and offering opportunities for timely treatment and a change in the overall course and outcome of ... risks and symptoms of cancer with the objective of promoting early diagnosis of the disease, and increasing appropriate access to diagnostic and treatment services The continuing education of professionals...

Ngày tải lên: 28/03/2014, 23:20

57 490 0
Báo cáo khoa học: "INTEGRATING MULTIPLE KNOWLEDGE SOURCES FOR DETECTION AND CORRECTION OF REPAIRS IN HUMAN-COMPUTER DIALOG*" potx

Báo cáo khoa học: "INTEGRATING MULTIPLE KNOWLEDGE SOURCES FOR DETECTION AND CORRECTION OF REPAIRS IN HUMAN-COMPUTER DIALOG*" potx

... fragments and filled pauses) in the corpus were of this type Table shows the distributions of these repairs with respect to two parameters: the length in words of the matched string, and the number of ... a preliminary study of cue words such as "no" and "well." And third, we discuss how acoustic information can aid in the detection of word fragments, which occur frequently and which pose difficulty ... 200-203 Shriberg, E., Bear, 3., and Dowding, J (1992 a) "Automatic Detection and Correction of Repairs in Human-Computer Dialog" Proceedings of the DARPA Speech and Natural Language Workshop,...

Ngày tải lên: 31/03/2014, 06:20

8 371 0
Báo cáo khoa học: "The detection and representation of ambiguities of intension and description" pptx

Báo cáo khoa học: "The detection and representation of ambiguities of intension and description" pptx

... h a t since the filler of the role Queen of England is not likely to change within the time of the conversation and the speaker, the hearer, and N a d i a are all aware of who fills t h a t role, ... intensionality of the descriptor, the time of reference of the descriptor, and the agents of the descriptor We m u s t establish the "level" of each factor in the target sentence and then determine ... intensionality, time, and agent of the descriptor equivalence asserted in the background assumptions to those of the target descriptor, and then assert the intensionality, time, and agent of the descriptors...

Ngày tải lên: 31/03/2014, 17:20

8 304 0
detection and analysis of genetic alterations

detection and analysis of genetic alterations

... more intricate, and thus more easily influenced folding of the strands (Highsmith, 1999) Detection and analysis of genetic alterations in normal skin and skin tumours The detection of fragments ... follicle Sebaceous gland Sweat gland Fat Figure Histological section of normal epidermis (A) and a schematic picture of the different layers of the skin (B) 25 Detection and analysis of genetic alterations ... Principles of methods used for detection of mutations/variations at defined positions 15 Detection and analysis of genetic alterations in normal skin and skin tumours Pyrosequencing The principle of...

Ngày tải lên: 10/04/2014, 22:12

81 346 0
Báo cáo sinh học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" docx

Báo cáo sinh học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" docx

... TOPO 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified ... agarose gel demonstrate that the combination of filtration, DNAse/ RNAse treatment and V8AAmer Random Multiplex PCR allows for the detection and identification of Adenovirus Type 17 without using any ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus...

Ngày tải lên: 18/06/2014, 18:20

11 387 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

... reaction contained µl of cDNA from the RT reaction, µl of 10× PCR Buffer, 1.5 mM MgCl2, µl of 10 mM each of dATP, dCTP, dGTP, and dTTP per reaction, µM each of primers and 2.5 units of Platinum Taq ... Sub-Programme (Dept of Agriculture and Food, Republic of Ireland) Thank you to Mr Noel Shanaghy and Mrs Breda Doody of Waterford Regional Hospital, Mr Eddie Beggan of Limerick Regional Hospital and Dr Jim ... Amplification of GII standards showing fluorescence versus cycle number concentration of × 107 – × 101 molecules are shown from left to right (B) Standard curve of GII assay R2 1.00 and a slope of -3.7...

Ngày tải lên: 18/06/2014, 18:20

8 535 1
Báo cáo sinh học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx

Báo cáo sinh học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx

... Recombination detection program RDP [48], GENECONV [19] and MAXIMUM CHI SQUARE [49], selected following the conclusions of studies on evaluation of different methods of recombination detection [50,51] ... the Chinese and Thai viruses were located in AV1, AV2, AC1 and AC4, whereas ORFs AV1 and AV2 were identified to be cold spots in the Bangladeshi viruses The frequency and locations of recombination ... forms, recombination hot spots and frequency of recombination documented in this study would provide new information for understanding the diversity and evolution of tomato-infecting begomoviruses...

Ngày tải lên: 18/06/2014, 18:20

10 567 0
Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx

Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx

... as the number of links between those two nodes (i.e., the number of times X and Y were co-cited) divided by the square root of the product of the frequency of X and the frequency of Y in the overall ... systematic analysis of publication and citation data from tens of thousands of articles can capture important features of active fields of scientific research, in this case in both cancer and cardiac ... importance of standardization and regulatory tools for both research and clinical care[34] Citation analysis also reveals evidence of ritual use of citations It is likely that many of the recent...

Ngày tải lên: 18/06/2014, 19:20

12 528 0
Báo cáo sinh học: "Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" pot

Báo cáo sinh học: "Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" pot

... MALDI-TOF/TOF MS and LC-ESI-Q-TOF MS This "shotgun" strategy resulted in a lower number of total spectra and identified a lower number of peptides, but yielded a comparable number of protein identifications ... 115–122) of the L3L protein Method 5: MALDI-TOF/TOF MS Direct trypsin digests of the membrane- and core-enriched fractions were also analyzed using MALDI-TOF/TOF MS to take advantage of complementary ... desorption ionization tandem mass spectrometer with time -of- flight/time -of- flight optics (MALDI-TOF/TOF), 2.) a quadrupole-time of flight mass spectrometer (LC-ESI-Q-TOF), and 3.) a quadrupole...

Ngày tải lên: 19/06/2014, 08:20

16 331 0
Báo cáo hóa học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" ppt

Báo cáo hóa học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" ppt

... TOPO 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified ... agarose gel demonstrate that the combination of filtration, DNAse/ RNAse treatment and V8AAmer Random Multiplex PCR allows for the detection and identification of Adenovirus Type 17 without using any ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus...

Ngày tải lên: 20/06/2014, 01:20

11 347 0
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt

Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt

... reaction contained µl of cDNA from the RT reaction, µl of 10× PCR Buffer, 1.5 mM MgCl2, µl of 10 mM each of dATP, dCTP, dGTP, and dTTP per reaction, µM each of primers and 2.5 units of Platinum Taq ... Sub-Programme (Dept of Agriculture and Food, Republic of Ireland) Thank you to Mr Noel Shanaghy and Mrs Breda Doody of Waterford Regional Hospital, Mr Eddie Beggan of Limerick Regional Hospital and Dr Jim ... Amplification of GII standards showing fluorescence versus cycle number concentration of × 107 – × 101 molecules are shown from left to right (B) Standard curve of GII assay R2 1.00 and a slope of -3.7...

Ngày tải lên: 20/06/2014, 01:20

8 502 0
Báo cáo hóa học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx

Báo cáo hóa học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx

... Recombination detection program RDP [48], GENECONV [19] and MAXIMUM CHI SQUARE [49], selected following the conclusions of studies on evaluation of different methods of recombination detection [50,51] ... the Chinese and Thai viruses were located in AV1, AV2, AC1 and AC4, whereas ORFs AV1 and AV2 were identified to be cold spots in the Bangladeshi viruses The frequency and locations of recombination ... forms, recombination hot spots and frequency of recombination documented in this study would provide new information for understanding the diversity and evolution of tomato-infecting begomoviruses...

Ngày tải lên: 20/06/2014, 01:20

10 352 0

Bạn có muốn tìm thêm với từ khóa:

w