design printing and post processing

... 37 Array design, printing and post- processing 38 RNA Purification, Reverse Transcription and cDNA Labeling 40 Array Hybridization and Scanning 41 Data Processing and Analysis ... my deepest and most heartfelt gratitude to my parents for instilling in me the discipline and sense of purpose to see this through I cannot thank them enough for their understanding and unconditional ... ACKNOWLEDGEMENTS First and foremost, I would like to express my gratitude to my adviser, Professor Miranda Yap for her support during my years at the Bioprocessing Technology Institute as both staff and student...

Ngày tải lên: 15/09/2015, 17:09

... the mean whole blood and serum antioxidative activity (CAT, GSHpx) and the mean blood and serum MDA and MPO values (oxidative activity), between the patients with anti-CCP(+) and those with anti-CCP(-) ... *p

Ngày tải lên: 25/10/2012, 11:15

... variation) is 4% and the inter-assay 5%, respectively Data are shown as the mean ± standard deviation or the median [interquartile range] Wilcoxon test was used to compare the pre- and post- interventional ... and motivational classes to increase physical activity such as walking and to instruct on the appropriate methods The Jichi 91 Medical University ethics committee approved the present study and ... hydrolysis and an enzymatic hydrolysis by plasma/serum and erythrocyte esterases (6) The circulating aspirin esterase activities are mainly due to butyrylcholinesterase (BChE, pseudocholinesterase) and, ...

Ngày tải lên: 26/10/2012, 09:39

... excitation and emission wavelength of 320 and 405, respectively) and data was quantified using standard curves provided with the kits For the studies of TIMP-1, samples and recombinant TIMP-1 standards ... blue and destained for 1-2 hours Measurement of MMP-8, MMP-9, and TIMP-1 activity MMP-8, -9 and TIMP-1 activity were quantified using ELISA-based activity assays (F8M00, F9M00, DTM100; R and D ... disease biomarkers and potential targets for intervention at 4° C for immunoblotting and quantitative analysis as outlined below MATERIALS AND METHODS ALI subjects Detection of MMP and TIMP isoforms...

Ngày tải lên: 03/11/2012, 11:48

... based on recommendations from German and international expert societies (e1, 8, e4, e5, 13) and on longstanding experience in the treatment, sports advice, and care provided in sports activities ... peers means improved quality of life and has a strong social and socializing aspect for children and adolescents Being forbidden to participate in sports and/ or limitations to the extent to which ... 2007; 104(9): A 563–9 ⏐ www.aerzteblatt.de MEDICINE Tables and and box show classifications of postoperative findings or clinical findings and their categorization into degrees of severity Category...

Ngày tải lên: 12/02/2014, 19:20

... (RU) for each IVIg preparation (B) Reactivity of native (lines and 4), pH buffer-exposed (lines and 5) and pH 2.8 buffer-exposed (lines and 6) IVIg with Bacillus anthracis antigens The membranes ... Immunology, Lorand Eotvos University, Budapest, Hungary) The commercial intravenous immunoglobulins Endobulin S ⁄ D (Baxter, Deerfield, IL, USA), and Octagam (Octapharma, Lachen, Switzerland) were ... Hospital, Paris) The Z2 antibody and IVIg samples were diluted in 0.1 m sodium acetate buffer (pH 4.0 or 2.8) and incubated for The pH was then brought to 7.0, and the samples were dialyzed against...

Ngày tải lên: 16/02/2014, 15:20

... All other reagents and buffer components were commercially available and of highest the purity Mutagenesis, construction and stable expression of recombinant mouse protein C and variants Mutagenesis ... alignment from different species and mouse protein C variants used in the present study N-terminal Gla sequence (1–44) is shown and defined between the propeptidase and chymotrypsin cleavage sites ... abilities (Fig 3A–C) Noticeably, mutants II and III stand out from the other proteins analyzed, obtaining the highest responses for all membrane types Mutants V and VII also show a significant binding-response...

Ngày tải lên: 18/02/2014, 06:20

... examined the political tendencies and biases of news reporters (Adkins Convert and Wasburn, 2007, Gentzkow and Shapiro, 2006 and 2004, Groseclose and Milyo, 2005, Lott and Hassett, 2004, Puglisi, 2004, ... Aiken Jessica Alba Jason Alexander Joan Allen Tim Allen Woody Allen Pedro Almodovar Robert Altman Anthony Anderson Gillian Anderson Paul Anderson Paul Thomas Anderson Wes Anderson Jennifer Aniston ... DeVany, A.S., and W.D Walls (2004) “Motion Picture Profit, the Stable Paretian Hypothesis, and the Curse of the Superstar” Journal of Economic Dynamics and Control Elberse, A., and B Anand (2005)...

Ngày tải lên: 19/02/2014, 10:20

... we compared frames separated by one other frame Thus, we contrasted Frames and 3, and 4, and 5, 136431 and 136433, and so forth, serially across each film This yielded a mean of about 165,000 ... Rathbone, and Olivia de Havilland; (b) Santa Fe Trail (1940, 0.018), a pre-Civil War epic with Flynn, de Havilland, Raymond Massey, and Ronald Reagan (as George Armstrong Custer); and (c) Blood ... Barrymore, and Lucy Liu; and (e) Mr and Mrs Smith (2005, 0.086), the Brad Pitt and Angelina Jolie vehicle for high-velocity domestic violence In each of these later films, there is dense and sustained...

Ngày tải lên: 19/02/2014, 14:20

... actin RNA was used to standardize the total amount of cDNA Primers for iNOS (GCTGCCAGGGTCACAAC TTT and ACCAGTGACACTGTGTCCCGT) and for beta actin (GCTTCTTTGCAGCTCCTTCGT and CGTCATCC ATGGCGAACTG) ... iNOS monomers and dimers in solubilized particulate fraction (P) and cytosol (C) of DLD-1 cells stimulated for 14 h with cytokines Lubrol ⁄ DOC extracts of particulate fraction and cytosols were ... cytosols were fractionated by gel filtration chromatography and column fractions were analyzed by SDS ⁄ PAGE and Western blot Fractions were designated to contain iNOS dimers or monomers based on...

Ngày tải lên: 19/02/2014, 16:20

... the tryptic digestion of the purified protein and subsequent analysis of the derived peptides by mass spectrometry If a candidate mass is detected and peptide sequencing proves, that there is ... 26–54) 816.2 (+ 4) and 850.2 (+ 4) represent the unmodified and the sulfonated peptide, respectively Two additional, fourfold charged peptides with m ⁄ z ¼ 855.67 (rmm: 3418.7) and with m ⁄ z ¼ ... dominant double and triple charged fragment ions To reduce the complexity, the spectrum was deconvoluted and the peptide sequence was obtained from the single charged y-fragment ions (…) and the b-fragment...

Ngày tải lên: 19/02/2014, 18:20

... verbs and verbal phrases like called, known as, defined as, termed, coined, dubbed, and descriptors such as term and word Other non-lexical markers included quotation marks, apposition and text ... FrameNet data from Name conferral and Name bearing frames to establish relevant arguments and linguistic realizations Corpus Tokenization Candidate extraction Candidate Filtering Collocations ♦ ... predictable and highly charged lexical environment of leading-edge research literature, the cauldron where knowledge and terminological systems are forged in real time, and where scienti- fic meaning and...

Ngày tải lên: 20/02/2014, 15:20

... The amino acid sequence enclosed in dark boxes and in open boxes are common sequences among ALP I and the neutral subtilisins, and among ALP I and the alkaline subtilisins, respectively s, Unique ... original activity after h, and 30% after h The D266NALP I showed 40 and 20% of the original activity after h and h of incubation, respectively The stability of Y269A/A271T/Q272R- and Y269A-ALP I in alkaline ... plasmid, pTnat3 + Nd, cleaved with NdeI and PstI and treated with calf alkaline phosphatase The plasmid carrying the fusion gene of the promoter region of aprN and the Ó FEBS 2002 The molecular surface...

Ngày tải lên: 21/02/2014, 03:20

... Kong SAR Hungary India Indonesia Ireland Israel Italy Japan Korea Latvia Lithuania Luxembourg Malaysia Mexico Netherlands New Zealand Norway Peru Philippines Poland Portugal Romania Russia Saudi ... Denmark Estonia Finland France Germany Greece Hong Kong SAR Hungary India Indonesia Ireland Israel Italy Japan Korea Latvia Lithuania Luxembourg Malaysia Mexico Netherlands New Zealand Norway Peru ... commercial and investment banks and securities houses that (1) participate in the interdealer market and/ or (2) have active business with large customers, such as large corporate firms, governments and...

Ngày tải lên: 06/03/2014, 02:21

... Crude protein extracts (lanes and 2), desalted protein extracts (lanes and 4), boiled extracts (lanes and 6) and no extract (lane 7) were assayed with [14C]arginine and 50 mM NaPO4 (i.e with no ... found in plants, animals and bacteria, and requires no external cofactors or metal ions for catalytic activity [51] The forward reaction (argininosuccinate to arginine and fumarate) is favored; ... material and protein extractions Leaves from 3-week old Arabidopsis plants (ecotype Columbia) grown under 16 h light conditions were harvested and ground in liquid N2 with a mortar and pestle...

Ngày tải lên: 07/03/2014, 05:20

... processing MHC II-associated invariant chain [24] in antigen processing and presentation [25,26] CatE is also reported to be involved in antigen processing by B cells [27,28] microglia [29] and ... proteinases, CatE and CatD, and can therefore be used to investigate the involvement of these enzymes in antigen processing and presentation Experimental procedures Enzymes and chemicals CatD ... (10 ng) and the antigenic peptide (SRFQPSQSSTYSQPG), and gave a complete negative reaction towards the same amount of CatD (10 ng) Values are mean ± SD, n ¼ (Insertion: 10 ng CatE and CatD and ng...

Ngày tải lên: 07/03/2014, 09:20

... depressed and never-depressed individuals completed tasks in which trials alternately required emotional processing and nonemotional processing A common approach to provoking emotional processing ... subject as a random factor, and group, scan, valence, and personal relevance as fixed factors Random effects analysis permits generalization of results at the population level and, hence, is ... depressed and control individuals on the administered tasks Since hypotheses for the valence identification involved sustained processing rather than early processing and since biases in early processing...

Ngày tải lên: 07/03/2014, 17:20

... (Derg5, expressing CYP11A1 and Tgl1p) and (CA10/pCD63 + pYeDP60) (Derg5, expressing CYP11A1) and in Dare Dare strains (CA23/pCD63 + pCD69) (Derg5, expressing CYP11A1 and Tgl1p) and CA23/pCD63 + pYeDP60) ... balance between the levels of free and esterified sterols is regulated by esterification and hydrolysis and is modified in strains disrupted for the estersynthase genes ARE and ARE ([20,28]), or in which ... Adxp and Adrp Materials and methods Culture conditions and genetic methods Yeast media, including SG (synthetic medium containing 2% glucose), SL (synthetic medium containing 2% galactose) and...

Ngày tải lên: 08/03/2014, 08:20

... from Arabidopsis and B napus, the forward primer VBE4 (5¢-ACCATG ACGTCCATTAACGTAAAGCTCC-3¢) and the reverse primer VBE3 (5¢-GGACCGACCGTTTTGGGCACG-3¢) were designed, synthesized and used to amplify ... B napus cv Hero and cv Westar, and from MDEs at mid-development from B rapa and B oleracea This was used as template DNA for PCR, carried out using Vent DNA polymerase (New England Biolabs) Amplified ... cells were able to utilize both 18:1 isomers (D9 and D11) as substrates for elongation reactions to produce 20:1 D11 and D13 isomers, and 22:1 D13 and D15 isomers, respectively The relative proportions...

Ngày tải lên: 08/03/2014, 09:20

... NADPH and PGDS activity [3.3 nmolÆmin)1Æ(mg protein))1] in the absence of NADPH or NADP+ However, AKR1B7 (71.2% and 69.6% identity with AKR1B1 and AKR1B3, respectively) and AKR1C3 (47.4% and 47.1% ... K77R, H110F and H110A mutants, and assessed their PGDS and PGFS activities with lm [1-14C]PGH2 at the optimum pH 8.5 for PGDS activity and pH 5.5 for PGFS activity in the absence and presence ... changed slightly both PGDS and PGFS activities (133% and 286% of wild-type AKR1B3, respectively), and the H110F mutant decreased the PGDS and PGFS activities to 37% and 1%, respectively The double...

Ngày tải lên: 14/03/2014, 23:20