... Functionally, differentiation was accompanied by the expression of aminopeptidase N, lactase, maltase and sucrase activities Sucrase-isomaltase is localized at the apical brush border membranes ... Tecnologica (BID 1201 ⁄ OC-AR, PICT 05–10607) ´ and Secretarı´ a de Ciencia y Tecnica de la Universidad ´ Nacional de Cordoba (SeCyT-UNC), Argentina EMG was a fellow from CONICET and GAR and CGM are ... have demonstrated that LT-I binding to blood group A- active glycosphingolipids from the plasma membrane of human adenocarcinoma HT29 cells elicits a signal transduction pathway, resulting in an...
Ngày tải lên: 30/03/2014, 10:20
Ngày tải lên: 16/12/2012, 15:24
Module 6: Deriving a Physical Data Design
... should map directly to tables within a relational database Good logical design is extremely important for good database design Tables can store a wide variety of data A table can contain a name, address, ... messaging and collaboration applications (With collaborative applications, many types of information tend be encapsulated in messages.) Relational Relational databases combine the advantages of ... information storage needs vary greatly An example of a hierarchical database is Microsoft® Exchange, which is capable of storing varying types of information in a format that facilitates messaging...
Ngày tải lên: 18/10/2013, 19:15
Tài liệu Retrieving a Single Value from a Query pdf
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
Ngày tải lên: 14/12/2013, 18:16
Tài liệu Module 4: Deriving a Logical Data Design doc
... Logical Data Design Logical Data Design Module 4: Deriving a Logical Data Design Entities and Attributes Activity 4.2: Creating a Logical Data Model Entity/Relationship Modeling Data Relationships ... Need for a Logical Data Design Slide Objective To discuss the reasons why a logical data design is necessary " A logical data design: $ Translates conceptual data needs into real data requirements ... a Logical Data Design 71 For example, consider the consultant, consultant manager, and administrative assistant from the Ferguson and Bardell, Inc case study All of them have a need to interact,...
Ngày tải lên: 21/12/2013, 06:18
Tài liệu Pass a Dataset Back from an XML Web Service docx
... - - - ... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... username once again The first table from the returned dataset is assigned to the DataSource property of dgUsers Listing 13.6 frmHowTo13_4.vb: Retrieving a Dataset from a Web Service Private Sub btnLogin_Click(ByVal...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Instructor Notes Module 4: Deriving a Logical Data Design pptx
... identify the cardinality and existence characteristics of the relationships ! Assign students to small groups and have them create an ER diagram with labeled relationships Then lead a class discussion ... Module 4: Deriving a Logical Data Design Activities Activity 4.1: Deriving Entities and Attributes from Data Requirements This activity provides students with a real-world example of use case requirements ... Try to anticipate all the alternative answers that the students might derive Activity 4.2: Creating a Logical Data Model In this activity, students identify relationships between entities, and then...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu Instructor Notes Module 6: Deriving a Physical Data Design doc
... workbook are generic Actual data types will vary depending on the databases that are used Instructor Notes Module 6: Deriving a Physical Data Design ! Implementing Relationships Again, for many students, ... 6: Deriving a Physical Data Design Activities Activity 6.1: Translating the Logical Data Design In this activity, students will evaluate the logical design for a portion of the Ferguson and Bardell, ... a review of material that they already know Plan to spend some extra time on the many-to-many design problem and how it is usually solved An additional example (for instance, students and classes...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu Figure Drawing Without A Model - Drawing from Life pptx
Ngày tải lên: 21/01/2014, 08:20
Tài liệu Getting a Sequence Value from Oracle pdf
... creating the sequence Oracle stores the definition of sequences for a database in a single data dictionary table in the SYSTEM table namespace As a result, all sequence definitions are always available ... CommandType.StoredProcedure; // Add the parameters and set values for them cmd.Parameters.Add(ID_PARM, OracleType.Int32).Direction = ParameterDirection.Output; cmd.Parameters.Add(FIELD1_PARM, OracleType.NVarChar, 50); ... generate a sequence of unique values for a primary key column, but is not related to the table containing the column As a result, a sequence generator can generate unique values for more than one...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Module 4: Deriving a Logical Data Design docx
... Logical Data Design Logical Data Design Module 4: Deriving a Logical Data Design Entities and Attributes Activity 4.2: Creating a Logical Data Model Entity/Relationship Modeling Data Relationships ... Need for a Logical Data Design Slide Objective To discuss the reasons why a logical data design is necessary " A logical data design: $ Translates conceptual data needs into real data requirements ... a Logical Data Design 71 For example, consider the consultant, consultant manager, and administrative assistant from the Ferguson and Bardell, Inc case study All of them have a need to interact,...
Ngày tải lên: 24/01/2014, 11:20
Tài liệu Voices of Fear and Safety¿ Women¿s ambivalence towards breast cancer and breast health: a qualitative study from Jordan pdf
... “Voices of Fear and Safety” Women’s ambivalence towards breast cancer and breast health: a qualitative study from Jordan Hana Taha1,2,3* Email: hana.taha@ki.se Raeda Al-Qutob4,5 Email: raeda@johud.org.jo ... Foundation, Amman, Jordan Abstract Background Breast cancer is the leading cause of cancer mortality among Jordanian women Breast malignancies are detected at late stages as a result of deferred breast ... physicians in Crete BMC Womens Health 2008, 8:20 28 Lamyian M, Hydarnia A, Ahmadi F, Faghihzadeh S, Aguilar-Vafaie ME: Barriers to and factors facilitating breast cancer screening among Iranian...
Ngày tải lên: 13/02/2014, 06:20
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It
... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... of my MFA work—papers, analysis, presentation—but college was an arena to develop other skills like leadership/team management and being a team player I argue that amazing games are near impossible ... games are still alive Some are still making games They have pioneered a great many genres, mastered programming algorithms and design patterns, and have learned to adapt to platform after platform...
Ngày tải lên: 13/02/2014, 17:23
a soft error tolerant sram design in 130nm cmos technology
... protons and neutrons Alpha particles are generated from the radioactive decay process and when they collide with other atoms Because of alpha particles cannot travel a long path in material, atmosphere ... main source of alpha particles, but an integrated circuit itself Packaging and soldering contain traces of radioactive isotopes, which lead to release the alpha particles as well as other particles ... Electronics applications nowadays always require a higher reliability level Many critical applications such as biomedical circuits, as well as space and military electronics devices demand extreme...
Ngày tải lên: 17/02/2014, 19:45
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... Conard J, Brosstad F, Lie Larsen M, Samama M & Abildgaard U (1983) Molar antithrombin concentration in normal human plasma Haemostasis 13, 363– 368 Skinner R, Abrahams JP, Whisstock JC, Lesk AM,...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually reside as oligomers similar...
Ngày tải lên: 22/02/2014, 04:20
Social Marketing: A Resource Guide from the Social Marketing National Excellence Collaborative doc
... outline a social marketing approach aimed at changing behaviors among your target audience Facilitators will be available during this workshop to answer questions Each group should appoint a spokesperson ... for assessment, design and late market penetration Feedback from target audiences was anecdotal Gatekeepers and health care professionals for the most part approved and helped distribute information ... These are the five foundations that support it They all need to be in place We can use the “P”s as a way to recognize and balance weaknesses in our programs (For example, you may have caring staff...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal model of septic ... IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± SD The significance of the results was assessed ... proinflammatory effects of fragments generated from extracellular matrix degradation by elastase are well documented For example, degradation products of elastin or heparan sulfate proteoglycan can...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt
... bound Covalent flavinylation was accompanied by an increase in oxidase activity and formation of hydrogen peroxide This confirms a mechanism of autocatalytic covalent flavinylation in which a reduced ... dehydrogenase, 36 kDa; carbonic anhydrase, 29 kDa; soybean trypsin inhibitor, 20 kDa; a- lactalbumin, 14.2 kDa; aprotinin, 6.5 kDa) Lane 2a: protein-stained cell-free extract Lane 3a: protein-stained cell-free ... primers: forward, 5¢-CACCATATGACG CGAACCCTTCCCCCA-3¢ (NdeI site is underlined); and reverse, 5¢-CACAAGCTTCAGAGGTTTTGGCCACGG-3¢ (HindIII site is underlined) After amplification, the DNA was digested...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khóa học: Localization, purification and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot
... These data indicated that the fractionation procedure was satisfactory and that the tetrathionate hydrolase is a periplasmic enzyme Purification of the tetrathionate hydrolase from tetrathionate-grown ... hydrolase activity was located to the soluble fraction Further fractionation to the periplasmic, cytoplasmic, and membrane fractions revealed that tetrathionate hydrolase (96%) and acid phosphatase ... was a homodimer with a molecular mass of 103 kDa as determined with MALDI-TOF MS Except for tetrathionate hydrolase from A ferrooxidans strain Funis-2 [20] all other tetrahionate hydrolases have...
Ngày tải lên: 07/03/2014, 14:20