... 34 Abdullah HA, Tarry C, Datta R, Mittal GS, Abderrahim M: A Dynamic Biomechanical Model to Assess and Monitor Robot-Assisted Therapy of Upper Limb Impairment” Journal of Rehabilitation Research ... that both groups had similar stages of motor impairment in the hand (Experimental, mean hand stage at admission 2.63 and at discharge 3.88 vs Control mean hand stage at admission 2.82 and at ... in age The covariates initial CAHAI and impairment score for the arm and hand and side of stroke were not significant for any outcome measure Age was a significant covariate for the outcome measures...
Ngày tải lên: 19/06/2014, 08:20
... protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evaporation on a glass substrate (0.8 × 7.0 cm) in a vacuum at a temperature of 65°C ... N, Yamamoto M, Kakiuchi T: Artificially phaseseparated binary self-assembled monolayers composed of 11-amino-1undecanethiolate and 10-carboxy-1-decanethiolate on Au(1 1): A comparative study of ... formation of aggregates in vitro Proc Natl Acad Sci USA 2003, 100:7021 26 Liu H, Zhang X, Gao Z: Lithography-free fabrication of large-area plasmonic nanostructures using colloidal gold nanoparticles...
Ngày tải lên: 21/06/2014, 04:20
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141
... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... Lusi, E .A. , Passamano, M., Guarascio, P., Scarpa, A. , Schiavo, L., 2009 Analytical Chemistry 81, 2819–2822 Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, ... The last set of experiments was conducted using human sera A human normal serum (which does not contain miRNA in detectable quantity) was diluted 50 times and used as a blank; it is referred as...
Ngày tải lên: 02/07/2014, 14:14
Báo cáo y học: " A biochemical hypothesis on the formation of fingerprints using a turing patterns approach" pps
... 190(2):478-500 17 Madzvamuse A, Thomas RDK, Maini PK, Wathen AJ: A numerical approach to the study of spatial pattern formation in the Ligaments of Arcoid Bivalves Bulletin of mathematical biology 2002, ... Bogotá, of Universidad Nacional de Colombia, under title Modelling in Mechanical and Biomedical Engineering, Phase II Author details Associate Professor, Mechanical and Mechatronics Engineering Department, ... on papillary patterns of human fingers Journal of Genetics 1924, 15(1):1-111 Hale A: Breadth of epidermal ridges in the human fetus and its relation to the growth of the hand and foot The Anatomical...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Children''''s unique experience of depression: Using a developmental approach to predict variation in symptomatology" potx
... periods of social change: The sample case of girls at puberty Journal of Personality and Social Psychology 1991, 61(1):157-168 Draguns JG, Tanaka-Matsumi J: Assessment of psychopathology across and ... factorial ANOVA with minority status (minority versus Caucasian) and the low and high mental age categories were used as independent variables and the internalizing ratio score was entered as ... the internalizing ratio score The sample's mean internalizing ratio score was 49 with a standard deviation of 25 The results indicate that mental age was a strong correlate of internalizing depressive...
Ngày tải lên: 13/08/2014, 18:21
Unilateral counterparty risk valuation of CDS using a regime switching intensity model
... trigger a cascade of defaults in the group See, for example, Shaked and Shanthikumar (1987), Jarrow and Yu (2001) and Yu (2007) Solving a contagion model faces an obstacle of looping default problem ... computation of the CVA, we not discuss them in detail Arbitrage-free valuation of unilateral counterparty risk In this section we aim at deriving the fair spread κ of a CDS without counterparty ... the marginal distributions of the default times have been derived, we can calculate various dependence measures which quantify the relation of pairwise default correlation, such as, the linear...
Ngày tải lên: 18/11/2016, 20:58
Báo cáo hóa học: " Source Depth Estimation Using a Horizontal Array by Matched-Mode Processing in the Frequency-Wavenumber Domain" pot
... omnidirectional point source at depth z = zs and range r = which radiates a broadband signal in a shallow water waveguide The acoustic field is sampled by a horizontal line array (HLA) of hydrophones placed ... Bogart and T C Yang, “Comparative performance of matched-mode and matched-field localization in a rangedependent environment,” The Journal of the Acoustical Society of America, vol 92, no 4, part ... water depth estimation for data recorded on a horizontal line array The recorded data are simulated in an oceanic waveguide made of a homogeneous water layer (D = 196 m, ρ1 = 1, V1 = 1500 m/s) and...
Ngày tải lên: 22/06/2014, 23:20
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy of ... software, version 15 (SPSS, Inc., Chicago, IL) Clinical data were expressed as the median ± the standard error of mean (minimum-maximum) The non-parametric Kruskal Wallis variance analysis was ... findings are also based on the result of macroscopic and histopathological examinations However, biochemical data would elucidate physiopathological changes associated with pleural adhesion and the...
Ngày tải lên: 25/10/2012, 11:00
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
... the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... original data can be considered appropriate Recently Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension ... such as COP control, is normal then a deviation away from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns...
Ngày tải lên: 03/11/2012, 10:09
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks
... from the field data In particular, these differences are increase at the high strain rate range The reason is that ANN model has not a lot of database on the high strain rate To eliminate this ... realize complex mapping In order to verify the applicability of MANN model, a total of 46 data of the consolidation test results are used 43 learning data are used for training the ANN model, and ... preconsolidation pressure ratio increases as the increase of strain rate and their trends are similar to those of the previous research In the case of sample D, the predicted values of ANN model are...
Ngày tải lên: 22/03/2013, 15:01
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
... and analysis The collection of reactors effluents was done daily to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are ... bioreactor may be employed as an alternative of the anaerobic reactors for treating several kind of wastewater such as industrial or municipal effluents References [1] Shivayogimath CB, Ramanujam ... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation...
Ngày tải lên: 05/09/2013, 16:11
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
... disposal of hazardous waste (co-disposal) Since the data available on the quantity, age, and composition of the refuse in the landfill are limited, using a more sophisticated calculation was not attempted ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter, ... behaviour of the model with respect to the parameters of the model” [11] In this paper, the concentration of NMOC, the average annual acceptance rate, and the age of the landfill were analyzed using...
Ngày tải lên: 05/09/2013, 16:11
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... geometric parameters shown in Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, ... [4] of the wake and apply it to determine the wake of a VAWT Now, the cross-section area of the streamtube is a square of width 2R and height H instead of a circle From the conservation of momentum, ... grid arrangement is also best in the case of a VAWT for optimal power generation Wake, power and cost modeling of a HAWT 2.1 Jensen's wake modeling of a HAWT All the results reported to date in...
Ngày tải lên: 05/09/2013, 17:03
Tài liệu tiếng anh Điện tử công suất mạch MERS Voltage rating reduction of magnetic power supplies using a magnetic energy recovery switch
... waveforms of generated current i and capacitor voltage v by the circuit of Fig Gate signals to U and Y of the full-bridge inverter and V and X of the MERS are also shown Gate signals of MERS are shifted ... power supply and the coil Both these parts of energy pulsate and cause voltage fluctuations of the capacitors The capacitors must maintain the voltage within a range; therefore the capacitors must ... voltage rating reduction causes decreasing of the DC capacitors In general, the DC capacitors occupy large part of the power supply in volume The DC capacitors store energy as large as several...
Ngày tải lên: 15/10/2013, 16:12
DC bus control of variable speed wind turbine using a buck boost converter
... improved on average by 24% VI ACKNOWLEDGEMENTS This work has been supported by the LTE Hydro-Québec, Natural Resources Canada and the Natural Sciences and Engineering Research Council of Canada VII ... REFERENCES C.L Kana; M Thamodharan and A Wolf; “System management of a wind-energy converter”, IEEE Tran Power Elec, Vol.16, Issue 3, pp 375 – 381, May 2001 [2] D S Zinger and E Muljadi, “Annualized wind ... improvement using variable speeds,” IEEE Trans Ind Applicat., vol 33, pp 1444– 1447, Nov./Dec 1997 [3] A Bouscayrol, Ph Delarue and X Guillaud, “Power strategies for maximum control structure of a wind...
Ngày tải lên: 03/01/2014, 19:15
Tài liệu Báo cáo "Numerical simulations of overland floods in urban areas using a conservative Godunov-type scheme " pptx
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
... program was complete, the trapped volatiles were analyzed using sub-ambient GC/MS TGA Conditions TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan A nitrogen atmosphere ... additional characterizations of representative samples of pure polymorphs of are given in Table Combined DSC/XRPD data, suggested forms, and additional characterizations of representative samples of ... dicarboxylic acid of molecular weight of about 400 Representative sample preparation conditions of various forms of are given in Table Note that a common starting material for the preparation of these samples...
Ngày tải lên: 14/02/2014, 03:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT ... 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions DENV-1...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx
... correct shade for direct composite resin restorations and can serve as a practical chairside alternative to the diagnostic wax-up It can also be used to create a lingual matrix for multilayered ... material is then removed at the gingival margin using a #12 blade or a flame carbide or diamond bur The patient can immediately see and appreciate the proposed result The diagnostic mock-up can ... teeth shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic...
Ngày tải lên: 19/02/2014, 17:20