... MATERIALS AND METHODS Plants and cyanobacterium Commercially obtained umbrella plant (Cyperus alternifolius) and Canna (Canna generalis) were used for testing, because the artificial floating islands ... Nakamura, K and Y Shimatani (1997) Water purification and environmental enhancement by the floating wetland Proceedings of the Asia Waterqual’97 in Korea, 888-895, Seoul Korea, 1997 Nakamura, ... 133-138 Hayashi, N., M Takayanagi, T Kuwabara, and Y Inamori (2003) Strategy on spreading the floating type edible aquatic plant purification system to developing countries J of Water and Waste,...
Ngày tải lên: 05/09/2013, 09:38
... as collagens, gelatin, and laminin, and also non-ECM proteins, including pro-tumor necrosis factor -a and a2 -macroglobulin [2] MMP-9 (gelatinase B) is secreted by neutrophils and macrophages and ... Matrilysin (matrix metalloproteinase-7): a new promising drug target in cancer and in ammation? Cytokine Growth Factor Rev 15, 111–115 36 Nagashima Y, Hasegawa S, Koshikawa N, Taki A, Ichikawa ... cleavage sites, respectively In summary, it can be stated that Gly and Ala occur at P1 in about 70% of the cleavages, whereas in the other 30% small amino acids such as Pro and Val are mainly...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: "The Second Release of the RASP System" pdf
... a great deal of lexically exceptional data These rules are compiled into an efficient C program encoding a deterministic finite state transducer The analyser takes a word form and CLAWS tag and ... This makes the system more easily retrainable after changes in the grammar and opens up the possibility of quicker tuning to in- domain data In addition, the structural ranking induced by the parser ... 3: Accuracy on DepBank Inui, K., V Sornlertlamvanich, H Tanaka and T Tokunaga (1997) A new formalization of probabilistic GLR parsing’, Proceedings of the 5th International Workshop on Parsing...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt
... ADPR + cADPR β-NAD + ADPR + cADPR Ado ADP 12 AMP ATP 14 Ado ADP AMP ATP 10 ADP ATP ST, BoNTA Ado β-NAD + ADPR + cADPR 100 LU AMP ATP Ado AMP ATP AMP ADP L Durnin and V N Mutafova-Yambolieva 16 18 ... bladder A B CD38+/+ PS β-NAD + ADPR + cADPR Ado ATP AMP β-NAD + ADPR + cADPR ST Ado β-NAD + ADPR + cADPR 100 LU ADP AMP ATP AMP ATP ST Ado ADP ADP Ado ADP AMP ATP ST, TTX ST, TTX β-NAD + ADPR + cADPR ... 3097 cADPR and CD38 modulate ATP release in the bladder B CD38+/+ A PS CD38–/– PS β-NAD + ADPR + cADPR β-NAD + ADPR + cADPR ADP Ado ADP ATP ST β-NAD + ADPR + cADPR ST Ado AMP ST, BoNTA β-NAD + ADPR...
Ngày tải lên: 05/03/2014, 23:20
Color Atlas of Dental Medicine: Aesthetic Dentistry pdf
... -Technical Procedure Preparation and Fit -Inlays and Onlays -Crowns and Bridges Ceramic Materials -Inlays, Onlays (Vita Celay Blank) -Crowns, Bridges (Vita CelayAlumina Blank) -Celay In- Ceram Spinell ... Abnormalities of the Chin Bilateral Horizontal Mandibular Hyperplasia Vertical Maxillary Hyperplasia Vertical Maxillary Hyperplasia, Mandibular Retrognathia, and Nasal Deformation Orthognathic ... technology has become both a teaching and learning tool in all areas of education and training Numerous training programs-used also in dentistry- are nowadays supported by instructional videos In different...
Ngày tải lên: 06/03/2014, 12:21
Extent of Dental Disease in Children Has Not Decreased, and Millions Are Estimated to Have Untreated Tooth Decay pptx
... contain more information on our NHANES and MEPS analyses Finally, we obtained information on oral health and the Medicaid population from CDC and from dental associations and experts including ... MEPS— administered by HHS’s Agency for Healthcare Research and Quality (AHRQ)—obtains nationally representative information on Americans’ health insurance coverage and use of health care, including ... necessary and must include relief of pain and infections, restoration of teeth, and maintenance of dental health Page GAO-08-1121 Medicaid Dental Services for Children Dental Disease and Inadequate...
Ngày tải lên: 14/03/2014, 09:20
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... pcDNA3.1-HSP70DPBD Sense of pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG ... GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC TCGGGTACCGGATCTACCTCCTCAATGGTG FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2621 ATP-binding ... activation [18] and mitochondrial depolarization [19], blocks apoptosome formation and activation of caspase-9 [20], and inhibits the release of apoptosisinducing factor (AIF) from mitochondria...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot
... ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA ... AK LF AK SF AK LR AK SR eIF 4A LF eIF 4A SF eIF 4A LR eIF 4A SR CAATCCATCAAAACCGTGTG TGCTACAGCAACTGGTGATCAGAAGGG CCCTTCCTGATCACCATGTTGCTGT GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ... a more than 30-fold increase in lactate, whereas the levels in controls remained constant The arginine kinase gene (AK) and the eukaryotic translation initiation factor 4A gene (eIF 4A, DQ667140)...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo Y học: Permeability transition-independent release of mitochondrial cytochrome c induced by valinomycin ppt
... inhibitors CsA and BKA As shown in Fig 1A, Ca2+ gradually accelerated the mitochondrial respiration with succinate as a substrate (upper trace b), as well as mitochondrial swelling (lower trace b), and ... increased mitochondrial respiration with no accompanying swelling, and CsA and BKA were ineffective in preventing accelerated respiration (Fig 1B) In contrast, as shown in Fig 1C, valinomycin accelerated ... protein)1Æmin)1) than the liver mitochondria (data not shown) When valinomycin was added to the brain mitochondria, CsA-insensitive acceleration of respiration was observed (data not shown), indicating...
Ngày tải lên: 17/03/2014, 10:20
Aesthetic Groundwater Quality Impacts from a Continuous Pilot-Scale Release of an Ethanol Blend pptx
... (NaBr) was injected at a depth of 22.5 cm below the water table at a rate of 0.4 L/d The NaBr was added as a conservative tracer, and to maintain a solution density to reach a neutral buoyancy ... References Alvarez, P.J., and W .A Illman 2005 Bioremediation and Natural Attenuation: Process Fundamentals and Mathematical Models Hoboken, New Jersey: Wiley-Interscience Atlas, R.M., and R Bartha 1993 ... B.S Lollar, F Pearson, L Balser, and D.M MacKay 2008 Comparative assessments of benzene, toluene, and xylene natural attenuation by quantitative polymerase chain reaction analysis of a catabolic...
Ngày tải lên: 30/03/2014, 16:20
in vitro release of ketoprofen from proprietary and extemporaneously manufactured gels
... signalling, emotions expressed), as well as a factor in xenophobia and bias against fellow humans that has shaped the destiny of humanity (12, 15, 16) The skin also serves as a barrier against ... anti-inflammatory and analgesic activities Although ketoprofen is rapidly absorbed, metabolized and excreted, it causes some gastrointestinal complaints such as nausea, dyspepsia, diarrhoea, constipation ... body of living animals or humans (36) The skin acts as a barrier to maintain the internal milieu, however, it is not a total barrier and many chemicals have been shown to penetrate into and through...
Ngày tải lên: 13/04/2014, 09:25
Báo cáo hóa học: " Involvement of intracellular free Ca2+ in enhanced release of herpes simplex virus by hydrogen peroxide" ppt
... 67:921-932 Oyama Y, Okazaki E, Chikahisa L, Nagano T, Sadakata C: Oxidative stress-induced increase in intracellular Ca2+ and Ca(2+)induced increase in oxidative stress: an experimental model using dissociated ... identified fura-2-loaded cells using alternating excitation wavelengths (340 and 380 nm) with an AQUACOSMOS ratio imaging application software (HAMAMATSU Photonics, Hamamatsu, Japan) and an inverted ... virus and oral mucositis in children with cancer Support Care Cancer 1994, 2:266-269 Hasina R, Matsumoto K, Matsumoto-Taniura N, Kato I, Sakuda M, Nakamura T: Autocrine and paracrine motility factors...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Hind-foot correction and stabilization by pins in plaster after surgical release of talipes equino varus feet in older children" pot
... wires, and at the final follow-up period The anteroposterior (AP) talo-calcaneal angle, (Kites angle), the AP talus -first metatarsal angle, the lateral tibio-calcaneal angle, and the lateral talo-calcaneal ... the lateral view, the preoperative talo-calcaneal angle ranged from 0°-14° (parallelism of the talus and calcaneus), with a mean of 5° The lateral tibio-calcaneal angle was always an acute angle ... used in revision cases including 19 Turco incisions and 14 Cincinnati incisions, while the Turco approach was used in only cases and the Cinncinati approach was used in 21 previously conservatively...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: "Sustained release of VEGF from PLGA nanoparticles embedded thermo-sensitive hydrogel in full-thickness porcine bladder acellular matrix" doc
... Furthermore, the shape of the injectant below the skin of the mouse was maintained in smooth and clear condition after 24 h, and the tissues around the injectant did not induce any inflammatory reaction, ... fluorescence signal was aggregated and weakened rapidly after injection, the solvent of the injectant was rapidly absorbed simultaneously, and the NPs were compressed and degraded in accelerated manner ... oral administration: an in vitro physico-chemical characterization J Biomed Nanotechnol 2009, 5: 45-53 Aggarwal S, Yadav S, Gupta S: EGFR targeted PLGA nanoparticles using gemcitabine for treatment...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo hóa học: " The Effect of Single, Binary and Ternary Anions of Chloride, Carbonate and Phosphate on the Release of 2,4-Dichlorophenoxyacetate Intercalated into the Zn–Al-layered Double Hydroxide Nanohybrid" pot
... micrographs were obtained In the single system release media, it could be observed that carbonate dominated the accumulated release Table Basal spacing and elemental analysis of Zn–Al-LDH (ZAN) and ... where at low concentration it can act as an auxin analogue, promoting plant growth but lethal to plants at high concentrations Therefore, 2,4-D is also used as an herbicide against broad-leafed and ... Fitting the data of the release of 2,4-D from the interlamellae of ZANDI, the nanohybrid into various aqueous solutions systems containing single, binary and ternary anions: chloride (a) , carbonate...
Ngày tải lên: 22/06/2014, 00:20
assess the efficiency of dental plaque control in decay teeth, gingivitis prevention for the 12 years- old pupils at some schools in the suburb of hanoi
... beverages (n=1022) Index Amount Scale (%) Number of time of eating, drinking sweet food and beverage and beverages each day: - Many times 703 68.8 Oral and dental hygience after eating, drinking ... of evaluating the situation of oral and dental disease at the equivalent groups, it was shown that there was the close connection between DP situation and oral and dental diseases In the intervention ... Stomatology major In Hanoi, the investigation results on the oral and dental health in 20072008 with the pupils of primary and secondary schools showed that the rate of oral and dental diseases...
Ngày tải lên: 25/07/2014, 13:57
Báo cáo lâm nghiệp:"Long-term effects of vegetation control treatments for release of Engelmann spruce from a mixed-shrub" pdf
... Simard and Heineman [44] found chemical and manual treatments ineffective in a willow dominated site Heavy rain soon after application may have affected herbicide efficacy and the cover was marginally ... balsamifera ssp trichocarpa (T & G.) Brayshaw) (Tab III) The LSD pairwise comparison test indicate that single manual cutting (treatment a and b), repeated manual cutting (treatment d, e and f), and ... forest land across the province was brushed, of which 46 333 were treated manually (including manual and motor-manual cutting, bending and girdling) Manual brushing represented 62% of total brushing...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo lâm nghiệp: " Release of oxalate and protons by ectomycorrhizal fungi in response to P-deficiency and calcium carbonate in nutrient solution" pptx
... as Pi + CaCO3 medium, contained 500 µM NaH2PO4 and g·L–1 of CaCO3 solid phase instead of CaCl2 The mineral was a reagent grade commercial product (Merck 2066) and was added to each flask before ... following steps: 0–3 min, 100% of elutant 1; 18 min, 70% of elutant and 30% of elutant Calibrations for retention times and peak areas were carried out with standard solutions containing oxalic acid ... 1C) 3.2 Oxalate production and calcium content Analysis of organic anions extracted from the mycelia or accumulated in culture solution showed that oxalate was always the main organic anion (>...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo khoa học: "The role of photoperiod and temperature in the induction and the release of dormancy in Pinus sylvestris L. seedlings" potx
... Dormancy breaking treatments of and wk had a dramatic influence, hastening the tilushing rate, especially in the plants with lowest degree of dormancy In Fig the same reactions to temperature and ... For that reason, deep dormancy will be used as the definition of the most dormant stage obtained There are no strict borderlines to phases before and after deep dormancy Early and late phases ... Lang (1987): &dquo;Dormancy is the temporary sus- different temperature dormancy inducing regimes treatment used as a Seedlings were was grown in pots with mineral wool as a substrate and watered...
Ngày tải lên: 09/08/2014, 02:21