degree of a vertex directed graph
Báo cáo hóa học: " Research Article Weight Identification of a Weighted Bipartite Graph Complex Dynamical Network with Coupling Delay" pot
Ngày tải lên: 21/06/2014, 07:20
Báo cáo toán học: "A conjecture of Biggs concerning the resistance of a distance-regular graph" potx
Ngày tải lên: 08/08/2014, 12:22
Báo cáo toán học: "The degree of a q-holonomic sequence is a quadratic quasi-polynomial" docx
Ngày tải lên: 08/08/2014, 14:23
Báo cáo toán học: "A simple Havel–Hakimi type algorithm to realize graphical degree sequences of directed graphs" ppsx
Ngày tải lên: 08/08/2014, 12:22
Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx
Ngày tải lên: 07/08/2014, 15:22
Báo cáo toán học: "Automorphism groups of a graph and a vertex-deleted subgraph" pot
Ngày tải lên: 08/08/2014, 12:22
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
... than two third of the sample rated it at 5. Variety of product lines went as the next important criteria with mean value was nearly 4.28 and half of sample rated it at 5. Convenient and easy assess ... Oriental Emporium, Prime Supermarkets and Yaohan are located in low and medium broad markets. In general, the market is dominated by the “political” NTUC FairPrice chain and a large presence of Japanese players ... Hong Kong and Singapore ã Transitional - Taiwan, South Korea, Thailand and Malaysia ã Traditional - Indonesia, the Philippines, and China Hong Kong’s population of 6.4 million enjoys one of the...
Ngày tải lên: 13/04/2013, 10:30
Fault tree synthesis from a directed graph model for a power distribution network
Ngày tải lên: 03/01/2014, 19:37
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... 39-year old man suffering with anxiety as a result of residual psychotic symptoms. Clinical Practice Report 5 was an oral presentation of a piece of clinical work completed with staff at a day ... by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a score of 0 denotes no available evidence ... people diagnosed by ESPAGAN guidelines were on gluten containing diet). Rashid, Cranney, Zarkadas, Graham, Switzer, Case, Molloy, Warren, Burrows & Butzner (2005) Canada Canadian...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... Spoken Dialogue Performance Analy- sis. In Proc. of EMNLP. M. Walker, D. Litman, C. Kamm and A. Abella. 2000. Towards Developing General Models of Usability with PARADISE. Natural Language Engineering. ... tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g. ... and C. L. Sidner. 1998. COLLAGEN: A Col- laboration Manager for Software Interface Agents. User Modeling and User-Adapted Interaction, 8(3-4). M. Rotaru and D. Litman. 2006. Exploiting Discourse...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic activity about twice that of wild-type E1. The single mutants E1aR26 7A and E1aD27 6A and the multiple mutants E1aY28 1A/ R28 2A/ S28 3A ... the active site (Fig. 1), as the main cleavage sites. Cleavage of the E 1a- subunit activated the enzyme, as determined by a decarboxylation assay of the free E1 in the presence of an artificial ... lane 5: E1aR26 7A mutant; lane 6: E1aR26 7A mutant + di-domain; lane 7: E1aD27 6A mutant; lane 8: E1aD27 6A mutant + di-domain. The gels for the other mutants were virtually identical (data not shown)....
Ngày tải lên: 20/02/2014, 23:20
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f 1 R is an integral domain. Let S be the subring of R generated ... Belolipetsky, Counting maximal arithmetic subgroups, preprint; available on arXiV as math.GR/0501198. [2] M. Bhargava, The density of discriminants of quartic rings and fields, Ann. of Math. 162 (2005), ... authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of this work was undertaken. We also thank Hendrik Lenstra for useful comments on an earlier draft. 2....
Ngày tải lên: 06/03/2014, 08:21
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... Â- CGCTACAGCCTCCTACNNNAT CGAAGGTGCTTGG-3Â, w ith AAC and GAG as the mutated codons for Q39N and Q39E, respectively. For mutation at position E451, the primer sequence was 5Â- GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3Â,withGAC,CAAandTCA as ... analysis Sandro R. Marana, Eduardo H. P. Andrade, Cle ´ lia Ferreira and Walter R. Terra Departamento de Bioquı ´ mica, Instituto de Quı ´ mica, Universidade de Sa ˜ o Paulo, Sa ˜ o Paulo, Brazil The ... designated 4 and 6, where ÔeÕ stands for an equatorial hydroxyl and a for a n axial one. Therefore, the interaction between any residue at position 39 and an equatorial 4-OH was called /4e, and...
Ngày tải lên: 16/03/2014, 18:20
A MASTER''''S PROJECT SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS IN NURSING potx
... used was an administrative database of medical and pharmacy claims of 16 self- insured employer health plans with approximately two million patients. The data were used to compare total payer ... Health Services Admininistration (SAMHSA), supplemented by other government data and analysis of a proprietary administration claims for an employed population. The results of the data analysis ... opioid abuse from a private payer's perspective. The research analysts focused on an average per-patient direct health care cost that was measured in 2003 United States dollars. The data source...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... loredano.pollegioni@uninsubria.it Abbreviations:DAAO, D -amino acid oxidase; RgDAAO, Rhodotorula gracilis D -amino acid oxidase; pkDAAO, pig kidney D -amino acid oxidase; XO, xanthine oxidase; IP, imino pyruvic acid; ... loop that adapts its conformation depending on the size of the ligand side chain) [27] and that Y238 of RgDAAO Table 5. Substrate specificity of wild-type and Y238 mutants of D -amino acid oxidase. All ... half-reaction of Y238 mutants with D -alanine was measured by mixing anaerobically a solution of each mutant enzyme with solutions containing varying concen- trations of D -alanine, such that...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... his- tone acetyltransferase domain of the human PCAF transcriptional regulator bound to coenzyme A. EMBO J 18, 3521–3532. 35 Ahmad S, Gromiha MM, Fawareh H & Sarai A (2004) ASAView: solvent accessibility ... domain of the human HAT P ⁄ CAF, with- out affecting its catalytic activity or substrate specific- ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a trans criptional coactivator with a variable ... (Hybond-C; Amersham Phar- macia, Piscataway, NJ, USA), western blotting and detec- tion using a fluorescently tagged anti-rabbit secondary (Licor, 800 nm). Stabilizing a human histone acetyltransferase...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC VL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC VL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC VL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link...
Ngày tải lên: 23/03/2014, 13:20
A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx
... of single atomic layers of graphene. We show that 66 Figure 5.1 (A) Schematic of a suspended graphene resonator. (B) An optical image of a double layer graphene sheet that becomes a ... large graphene flakes (Han, Ozyilmaz et al. 2007) and in narrow chemically synthesized graphene ribbons (Li, Wang et al. 2008). 3.5 Mechanical Properties of Graphite and Graphene Graphite ... oxide surface via van der Waals attraction (Fig. 5. 1A, 5.1D). 5.3 Device Characterization – AFM and Raman A non-contact mode AFM was used to quantitatively measure the thickness of the sheets...
Ngày tải lên: 24/03/2014, 05:20