degree of a vertex directed graph
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
... than two third of the sample rated it at 5. Variety of product lines went as thenext important criteria with mean value was nearly 4.28 and half of sample rated it at 5.Convenient and easy assess ... Oriental Emporium, PrimeSupermarkets and Yaohan are located in low and medium broad markets. In general, themarket is dominated by the “political” NTUC FairPrice chain and a large presence of Japaneseplayers ... Hong Kong and Singaporeã Transitional - Taiwan, South Korea, Thailand and Malaysiaã Traditional - Indonesia, the Philippines, and China Hong Kong’s population of 6.4 million enjoys one of the...
- 51
- 1,039
- 3
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... 39-year old man suffering with anxiety as a result of residual psychotic symptoms. Clinical Practice Report 5 was an oral presentation of a piece of clinical work completed with staff at a day ... by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a score of 0 denotes no available evidence ... people diagnosed by ESPAGAN guidelines were on gluten containing diet). Rashid, Cranney, Zarkadas, Graham, Switzer, Case, Molloy, Warren, Burrows & Butzner (2005) Canada Canadian...
- 171
- 709
- 0
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... Spoken Dialogue Performance Analy-sis. In Proc. of EMNLP. M. Walker, D. Litman, C. Kamm and A. Abella. 2000. Towards Developing General Models of Usability with PARADISE. Natural Language Engineering. ... tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g. ... and C. L. Sidner. 1998. COLLAGEN: A Col-laboration Manager for Software Interface Agents. User Modeling and User-Adapted Interaction, 8(3-4). M. Rotaru and D. Litman. 2006. Exploiting Discourse...
- 8
- 515
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... DCPIPassay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic activity about twice that of wild-type E1. The singlemutants E1aR26 7A and E1aD27 6A and the multiplemutants E1aY28 1A/ R28 2A/ S28 3A ... the active site (Fig. 1), as the maincleavage sites. Cleavage of the E 1a- subunit activated theenzyme, as determined by a decarboxylation assay of thefree E1 in the presence of an artificial ... lane 5: E1aR26 7A mutant; lane 6:E1aR26 7A mutant + di-domain; lane 7: E1aD27 6A mutant; lane 8:E1aD27 6A mutant + di-domain. The gels for the other mutants werevirtually identical (data not shown)....
- 10
- 459
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... (This data was obtained with the commands InvariantRing,PrimaryInvariants, and SecondaryInvariants in Magma.) One checks thatR = R/f1R is an integral domain.Let S be the subring of R generated ... Belolipetsky, Counting maximal arithmetic subgroups, preprint; available on arXiVas math.GR/0501198.[2]M. Bhargava, The density of discriminants of quartic rings and fields, Ann. of Math.162 (2005), ... authors are grateful for the hospitality of theAmerican Institute of Mathematics, where the first phase of this work wasundertaken. We also thank Hendrik Lenstra for useful comments on an earlierdraft.2....
- 20
- 478
- 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... Â-CGCTACAGCCTCCTACNNNATCGAAGGTGCTTGG-3Â, w ith AAC and GAG as themutated codons for Q39N and Q39E, respectively. Formutation at position E451, the primer sequence was5Â-GGAGTCTAATGGACAACTTTNNNTGGATGGAGGGTTATATTGAGCG-3Â,withGAC,CAAandTCAas ... analysisSandro R. Marana, Eduardo H. P. Andrade, Cle´lia Ferreira and Walter R. TerraDepartamento de Bioquı´mica, Instituto de Quı´mica, Universidade de Sa˜o Paulo, Sa˜o Paulo, BrazilThe ... designated 4 and 6, where ÔeÕ stands for an equatorialhydroxyl and a for a n axial one. Therefore, the interactionbetween any residue at position 39 and an equatorial 4-OHwas called /4e, and...
- 9
- 371
- 0
A MASTER''''S PROJECT SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS IN NURSING potx
... used was an administrative database of medical and pharmacy claims of 16 self-insured employer health plans with approximately two million patients. The data were used to compare total payer ... Health Services Admininistration (SAMHSA), supplemented by other government data and analysis of a proprietary administration claims for an employed population. The results of the data analysis ... opioid abuse from a private payer's perspective. The research analysts focused on an average per-patient direct health care cost that was measured in 2003 United States dollars. The data source...
- 20
- 552
- 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... loredano.pollegioni@uninsubria.itAbbreviations:DAAO,D-amino acid oxidase; RgDAAO, RhodotorulagracilisD-amino acid oxidase; pkDAAO, pig kidneyD-amino acidoxidase; XO, xanthine oxidase; IP, imino pyruvic acid; ... loopthat adapts its conformation depending on the size of theligand side chain) [27] and that Y238 of RgDAAOTable 5. Substrate specificity of wild-type and Y238 mutants of D-amino acid oxidase. All ... half-reaction of Y238 mutants withD-alaninewas measured by mixing anaerobically a solution of eachmutant enzyme with solutions containing varying concen-trations of D-alanine, such that...
- 10
- 496
- 0
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... his-tone acetyltransferase domain of the human PCAFtranscriptional regulator bound to coenzyme A. EMBOJ 18, 3521–3532.35 Ahmad S, Gromiha MM, Fawareh H & Sarai A (2004)ASAView: solvent accessibility ... domain of the human HAT P ⁄ CAF, with-out affecting its catalytic activity or substrate specific-ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a transcriptional coactivator with a variable ... (Hybond-C; Amersham Phar-macia, Piscataway, NJ, USA), western blotting and detec-tion using a fluorescently tagged anti-rabbit secondary(Licor, 800 nm).Stabilizing a human histone acetyltransferase...
- 13
- 226
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCCJH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCCJH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCCL. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCCVK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCCVK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCCVL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCCVL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACCVL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCCVL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTCVL6.link...
- 11
- 679
- 0
A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx
... of single atomic layers of graphene. We show that 66 Figure 5.1 (A) Schematic of a suspended graphene resonator. (B) An optical image of a double layer graphene sheet that becomes a ... large graphene flakes (Han, Ozyilmaz et al. 2007) and in narrow chemically synthesized graphene ribbons (Li, Wang et al. 2008). 3.5 Mechanical Properties of Graphite and Graphene Graphite ... oxide surface via van der Waals attraction (Fig. 5. 1A, 5.1D). 5.3 Device Characterization – AFM and Raman A non-contact mode AFM was used to quantitatively measure the thickness of the sheets...
- 140
- 510
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25