deformation of a drop in a general linear flow

... J Am Podiatr Med Assoc 1993, 83:475-483 65 Harris RI, Beath T: Army Foot Survey An investigation of foot ailments in canadian soldiers Ottawa: National Research Council of Canada 1947 66 Helfand ... feet in the process of ageing of man Ortop Travmatol Protez 1980, 9:31-34 81 Robinson J: The Aldersgate Study Bedford Park, Australia: Flinders Medical Centre 1989 82 Saez Aldana F, Martinez Galarreta ... systematic review investigating the prevalence of HV and the influence of age and gender Therefore, the aim of this systematic review and meta-analysis was to examine HV prevalence in the overall...

Ngày tải lên: 10/08/2014, 21:24

... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1411-1575 165 F2-3 TGCAGGGATCCATGAATGACGACCAGTTAGAT GTCGACTTAAGCTAATGGTCCAGTAGA 1531-1731 201 F4 F5 TGCAGGGATCCATGAATGACGACCAGTTAGAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT TGCAGGGATCCATGGACGACCAGTTAGATGGT ... F12 F13 TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT GATCCATGATCTATTATCCGGGGTAAG TCGACTTACCCCGGATAATAGATCATG 1558-1575 1558-1572 18 15 F14 GATCCATGTATTATCCGGGGGAATAAG 1561-1575 ... GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681-2124 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT CTTTGGTCGACTTAATCTCCAGATTCGACGGC 1294-1455 162 F2-2 TGCAGGGATCCATGGCAATTGCTGCAGATAGG CTTTGGTCGACTTATTCCCCCGGATAATAGAT...

Ngày tải lên: 12/08/2014, 01:21

... evaluating the merits and drawbacks of various treatment alternatives As partial compensation for the potential drain that individualized assessments can place on already burdened clinical staff, ... As a result, this scaling method was associated with a greater proportion of meaningful variance across a variety of parametric analyses Moreover, a commonly cited advantage of VAS type scales ... satisfaction with healthcare in an observational database: results of a validation study using data from CaPSURE Am J Manag Care 2000, 6:70-76 Westbrook JI: Patient satisfaction: methodological...

Ngày tải lên: 20/06/2014, 15:20

... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... http://www.almob.org/content/4/1/5 positive linear class of functions and involving (N + 2I) variables (Problem (5)) offers substantial computational advantages over a formulation based on a general linear ... a gene is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph  parametrized by a sparse matrix W, a...

Ngày tải lên: 12/08/2014, 17:20

... database of the Capital area and in the laboratory database Data collection Data on performed split test procedures is retrieved from the laboratory database These data not contain any patient-related ... baseline period and that are not already included in RCT A Practices are allocated to ComRem together with usual laboratory EQA practice or usual laboratory EQA practice only The comparison of ... read and approved the final manuscript Competing interests This survey was initiated by FBW, who is a GP in the study area PF and NM are working in the Laboratory providing data and EH is a director...

Ngày tải lên: 10/08/2014, 11:20

... [41] Finally, Type D was a strong predictor of adverse cardiac outcome after acute myocardial infarction, and the associated risk was similar to that of traditional cardiovascular risk factors ... Six studies examined behavioral and biological mechanisms of disease as a function of Type D personality in apparently health individuals (Table - section a) Regarding behavioral mechanisms, two ... D was also associated with a decreased activity in the amygdala in response to fearful expressions [10], suggesting inadequate emotion-processing in the brain Finally, heritability might be an...

Ngày tải lên: 18/06/2014, 19:20

... wanted" in all aspects of life at baseline indicated that they were not doing so in at least one aspect of life three years later, whereas almost one third of those who had a restriction at baseline ... lost at follow-up had the same likelihood of participation restriction (examining onset and persistence separately), within strata defined by age, gender, educational attainment, occupational class ... was calculated as those with restriction in an aspect of life at both baseline and follow-up To examine the link between onset of restriction in each aspect of life and amount of restriction at...

Ngày tải lên: 18/06/2014, 19:20

... general population with a standard deviation of 10 Validation measures We used a number of validation measures available from the SAPALDIA database that met the Global Initiative for Asthma criteria ... pain", "social functioning" and "role emotional" domains The "general health", "vitality" and "mental health" domains showed almost normal distributions Cronbach alpha was above 0.7 for all AQLQ ... in the respective area for at least three years, were drawn from the local registries of inhabitants of these areas Health examinations were conducted at the eight local centres at baseline in...

Ngày tải lên: 18/06/2014, 22:20

... classical variational inequality VI C, A In 2006, Aoyama et al first considered the following generalized variational inequality problem in Banach spaces Let A : C → X be an accretive operator ... A3 problem 1.10 in a real Hilbert space Second, we introduce iteration process for finding a solution of a new general system of variational inequalities in a real Banach space Starting with arbitrary ... 548–558, 2008 Y Yao, M A Noor, K Inayat Noor, Y.-C Liou, and H Yaqoob, “Modified extragradient methods for a system of variational inequalities in Banach spaces,” Acta Applicandae Mathematicae, vol 110,...

Ngày tải lên: 21/06/2014, 07:20

... 19 X Qin and Y Su, “Approximation of a zero point of accretive operator in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 329, no 1, pp 415–424, 2007 10 G Marino and Hong-Kun ... leur application aux e’quations inte’grales,” Fundamenta Mathematicae, vol 3, pp 133–181, 1922 A Meir and E Keeler, A theorem on contraction mappings,” Journal of Mathematical Analysis and Applications, ... “Construction of fixed points of nonlinear mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol 20, pp 197–228, 1967 S Banach, “Surles ope’rations dans les ensembles abstraits...

Ngày tải lên: 21/06/2014, 11:20

... introduced a new mapping, called Kmapping, for finding a common fixed point of a finite family of nonexpansive mappings For a finite family of nonexpansive mappings {Ti }N1 and sequence {γn,i }N in 0, ... Proceedings of the American Mathematical Society, vol 4, pp 506–510, 1953 S Reich, “Weak convergence theorems for nonexpansive mappings in Banach spaces,” Journal of Mathematical Analysis and Applications, ... same argument as in 9, Lemma 2.10 , we obtain the following lemma Lemma 1.8 Let C be a nonempty closed convex subset of Banach space Let {Ti }N1 be a finite family of i nonexpanxive mappings of...

Ngày tải lên: 21/06/2014, 11:20

... localizing than the excited states in QWs These changing trends are found in Fig In summary, we proposed a linear Rashba model along the z direction and calculated the splitting energy of a hydrogenic ... dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit splitting energy C as the position of the impurity under the linear Rashba model along ... hydrogenic donor impurity in a GaAs=Ga0:65 Al0:35 As QW We take the effective mass parameters of [13] and the Rashba parameter a0 ¼ 10À12 eV m [14] The spin-orbit splitting energy C is defined by...

Ngày tải lên: 22/06/2014, 01:20

... Shang: Department of Mathematics, Tianjin Polytechinc University, Tianjin 300160, China; Department of Mathematics, Shijiazhuang University, Shijiazhuang 050035, China Email address: meijuanshang@yahoo.com.cn ... pseudocontractive mappings,” Advances in Nonlinear Variational Inequalities, vol 6, no 2, pp 91–99, 2003 [8] R U Verma, “Generalized system for relaxed cocoercive variational inequalities and projection ... quadratic programming, and variational problems In this paper, we consider, based on the projection method, the approximation solvability of a system of nonlinear relaxed cocoercive variational...

Ngày tải lên: 22/06/2014, 18:20

... closely related to relapses and aggravations of respiratory disease, especially in men, pointing to a link between psychological factors and chronic pulmonary disease [19] Patients with COPD cannot ... forms of COPD [15], a fact also verified in our study Depression may be a very important negative factor to treatment adherence for patients with somatic disease Additionally, it may hinder adaptation ... disease conditions and it is known that adaptation is a crucial survival factor in chronic diseases [22] Conclusion Patients suffering from BA and COPD have a significantly higher rate of anxiety...

Ngày tải lên: 08/08/2014, 23:20

... acquisition, analysis and interpretation of data and was involved in drafting the manuscript FAO-O participated in acquisition of data and was involved in drafting the manuscript DAK was involved in acquisition ... design of the study and was involved in drafting the manuscript and revising it critically for intellectual content LIK participated in acquisition, analysis and interpretation of data and was involved ... involved in drafting the manuscript and revising it critically for intellectual content MWK contributed in acquisition of data and was involved in interpretation of data VNM participated in acquisition,...

Ngày tải lên: 08/08/2014, 23:21

... presence of a CCS in the CHS Regular training and supervision of staff in the assessment and psychosocial care and aftercare of patients admitted to EDs of general hospitals following a suicide attempt, ... with hospitals that had written guidelines with a quality assurance system, training and systematic supervision of staff and routinely gave patients information about available aftercare providers/services ... that interventions aimed at establishing and maintaining structured collaboration with aftercare providers and a team or coordinator at the hospital level might be important aspects in fostering...

Ngày tải lên: 08/08/2014, 23:21

... Hospital, Yun-Lin Branch, Yun-Lin, Taiwan 7Changhua Christian Hospital, Lu-Tung Branch, Changhua, Taiwan 8Wei Gong Memorial Hospital, Miaoli, Taiwan 9Cathay General Hospital, Taipei, Taiwan 10Catholic ... Hirose T, Uwahodo Y, Yamada S, Miwa T, Kikuchi T, Kitagawa H, Burris KD, Altar CA, Nabeshima T: Mechanism of action of aripiprazole predicts clinical efficacy and a favourable side-effect profile J ... 3Peaceful Mind Psychiatry Clinic, Taoyuan, Taiwan 4Buddhist Tzu Chi General Hospital and University, Hualien, Taiwan National Cheng Kung University Hospital, Tainan, Taiwan 6National Taiwan University...

Ngày tải lên: 09/08/2014, 01:21

... Canadian Osteoarthritis Hand Index; CMCJ = carpometacarpal joint; DIPJ = distal interphalangeal joint; GP = General practice; MTPJ = metatarsophalangeal joint; MCPJ = metacarpophalangeal joint; NRS ... Calverley, Charlotte Clements, Kathryn Dwyer, Ian Thomas and Chan Vohora; staff of the participating general practices and Haywood Hospital, especially Dr Jackie Saklatvala, Carole Jackson and ... Dimensionality and clinical importance of pain and disability in hand osteoarthritis: Development of the Australian/ Canadian (AUSCAN) Osteoarthritis Hand Index Osteoarthritis Cartilage 2002,...

Ngày tải lên: 10/08/2014, 21:24

... Rieger MA, Butzlaff M: [Multimodal training of general practitioners–evaluation and knowledge increase within the framework of the dementia management initiative in general medicine (IDA)] Z Arztl ... size of 1.5 appeared to be too optimistic A study in an US hospital compared an online training with a classical face-to-face training and assumed an effect size of 0.75 [10] Extensive investigation ... was conducted in a setting of GPs QCs in urban and rural areas of the western part of Germany [25] QCs are regular regional meetings of GPs to discuss clinical topics, guidelines, and other ways...

Ngày tải lên: 11/08/2014, 05:21

... Funding of the Pirkanmaa Hospital District Author details Vaasa Hospital District and National Institute for Health and Welfare, Psychiatric Unit of Vaasa Central Hospital, Sarjakatu 2, Vaasa, ... Lapua, Finland 4National Institute for Health and Welfare, Psychiatric Unit of Vaasa Central Hospital, Sarjakatu 2, Vaasa, FI65320, Finland Authors’ contributions All authors have read and approved ... disorder had had contact with health care professionals during the last year Internationally this is a rather positive result but far from optimal Another result was also alarming: the prevalence of...

Ngày tải lên: 11/08/2014, 15:22