defining vectors for a linear gradient

... the assumption of a global translation motion model and the space invariant degradation models It also has limited ability for inclusion of knowledge of spatial domain properties for regularization ... image along the scan direction 3.1 Imaging Device The imaging device consists of a linear actuator and a high definition (HD) camera, and two line lasers The camera is mounted on a under carriage ... ̅ tan .Eq (4) are the estimated coordinates of the vanishing point Camera tilt (α) between optical axis and the line perpendicular to linear axis on optical axis + linear axis plane, α | | tan...

Ngày tải lên: 24/08/2014, 10:38

... Galo, I Albarreal, M.C Calzada, J.L Cruz, E Fernandez-Cara, M Mari´n, Stability and Convergence of a Parallel ´ Fractional Step Method for the Solution of Linear Parabolic Problems, Applied Mathematics ... Marszalek, Z Trzaska, A Boundary-value Problem for Linear PDAEs, Int.J.Appl.Math.Comput.Sci., Vol 12, No (2002) 487 [3] T Lu, P Neittaanmaki, X.C Tai, A Parallel Splitting-up Method for Partial ... Adams, New Parallel Method by Domain Partitioning, SIAM J Sci Comput Vol 20, No (1999) 2261 [9] C.Zhang, Hong Lan, Y.E.Yang, B.D Estrade, Parallel SOR Iterative Algorithms and Performance Evaluation...

Ngày tải lên: 13/02/2014, 03:20

... The SRLW equation also arises in many other areas of mathematical physics 4–6 Numerical investigation indicates that interactions of solitary waves are inelastic ; thus, the solitary wave of the ... pseudospectral methods for the generalized symmetric regularized long wave equations,” Acta Mathematicae Applicatae Sinica, vol 26, no 4, pp 590–604, 2003 12 Y Bai and L M Zhang, A conservative finite ... initial value problem for dissipative generalized symmetric regularized long wave equations,” Acta Mathematica Scientia Series A, vol 23, no 6, pp 745–757, 2003 18 B Guo and Y Shang, “Approximate...

Ngày tải lên: 21/06/2014, 11:20

... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, ... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion...

Ngày tải lên: 21/06/2014, 20:20

... and applications to PDE’s,” to appear in Proceedings of the American Mathematical Society Alessia Elisabetta Kogoj: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato ... Bologna, Italy Email address: kogoj@dm.unibo.it Ermanno Lanconelli: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato 5, 40126 Bologna, Italy Email address: lanconel@dm.unibo.it ... theorems for a class of hypoelliptic ultraparabolic equations,” in Geometric Analysis of PDE and Several Complex Variables, vol 368 of Contemporary Math., pp 305–312, American Mathematical Society,...

Ngày tải lên: 22/06/2014, 19:20

... and applications to PDE’s,” to appear in Proceedings of the American Mathematical Society Alessia Elisabetta Kogoj: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato ... Bologna, Italy Email address: kogoj@dm.unibo.it Ermanno Lanconelli: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato 5, 40126 Bologna, Italy Email address: lanconel@dm.unibo.it ... theorems for a class of hypoelliptic ultraparabolic equations,” in Geometric Analysis of PDE and Several Complex Variables, vol 368 of Contemporary Math., pp 305–312, American Mathematical Society,...

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 05/08/2014, 15:20

... duals are lattice polytopes are characterised by having palindromic vectors This can also be derived from Stanley’s work [Sta78] on Gorenstein rings References [BR07] Matthias Beck and Sinai ... Combinatorial mathematics, optimal designs and their applications (Proc Sympos Combin Math and Optimal Design, Colorado State Univ., Fort Collins, Colo., 1978) the electronic journal of combinatorics ... Undergraduate Texts in Mathematics, Springer, New York, 2007, Integer-point enumeration in polyhedra [BS07] Matthias Beck and Frank Sottile, Irrational proofs for three theorems of Stanley, European...

Ngày tải lên: 07/08/2014, 15:22

... conventional fashion Echocardiography All patients will have standard two-dimensional echocardiographic examinations before and after AVR LV ejection fraction is assessed visually by a trained echocardiographer ... disease that are worse than mild as assessed clinically and/ or confirmed by pulmonary function testing (Table 1) The baseline and follow-up clinical variables and pharmacological data are obtained ... that systolic and diastolic IVPG, a marker of normal left ventricular function, may be related to physiological asynchrony between basal and apical myocardial segments and that they can be attenuated,...

Ngày tải lên: 10/08/2014, 09:21

... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph  parametrized by a sparse matrix W, a matrix with ... statistically using gold standard data and evaluation metrics from the Dialogue for Reverse Engineering Assessments and Methods (DREAM) initiative [36] The LP-based approach compares favourably with algorithms ... class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values for...

Ngày tải lên: 12/08/2014, 17:20

... 5'-GGTATGCGGCCGCTTATGAAGTGGGTAACCTTTAT-3' without Kozak or using 5'-GTATGCGGCCGCCACCATGAAGTGGGTAACCTTTAT-3' with Kozak sequence and 5'CGCTAGGATCCAATCAATGGTGATGGTGATGATG-3' Taq DNA Polymerase (New ... EcoRI and XhoI and ligated with T4 DNA ligase into pcDNA3.1/V5-His (Invitrogen) (H1) The gene was amplified using primers 5'-GGTGTGAATTCCATGAAGTGGGTAACCTTTAT-3' and 5'-GGTGTCTCGAGCGTAAGCCTAAGGCAGCTTGA-3' ... found as an initiation signal for gene translation as in other vertebrates [21] For equine arteritis virus suboptimal intraleader AUG and not an optimal Kozak sequence has been shown to be critical...

Ngày tải lên: 12/08/2014, 18:22

... fragment, containing the poly (A) site of SV40, was amplified using (+) TAGCCCGGGATAAGATACATTGATGAGT and (-) TAGGAATTCATCATAATCAGCCATACCAC and cleaved with SmaI and EcoRI The DNA from step (A) ... GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTTGGG and (-) CCCAAGGAACAAAGCTCCTATTCTACAGTCATCAATATCCC produced a 1457 bp fragment with a 1448 bp deletion in Env (pos 6307–7755) It was cleaved with EcoRI and HpaI (C): A ... fragments were ligated into BssHII and EcoRI of pHD1 [7] (B): PCR of pNL4-3 with the terminal primers (+) CATAATAAGAATTCTGCAAC and (-) CAAGTTAACAGCACTATTC and the fusion primers (+) GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTTGGG...

Ngày tải lên: 13/08/2014, 09:21

... Data analysis Data were analysed separately for each line Two methods to estimate genetic parameters were compared: 1) LAM, a linear animal model including direct and associative effects applied ... parameters are given on the hazard rate scale, the probability that an animal has a failure at a given time t, whereas genetic parameters of LAM are on the observed scale for survival days The difference ... Furthermore, linear models not properly account for the nature of survival data, because survival data are usually heavily skewed [14] Survival analysis [15] appropriately accounts for both censoring and...

Ngày tải lên: 14/08/2014, 13:21

... Regulatory authorities also have a role to play Clinical trials are based on extensive preclinical experimentation and animal trials that take many years to complete Clearly, the particular vector ... external enhancers and silencing chromatin Proc Natl Acad Sci (USA) 2002, 99:16433-16437 Rameezani A, Hawley TS, Hawley RG: Performance- and safetyenhanced lentiviral vectors containing the human ... one instance where a vector contaminated with a replication competent virus was administered to animals viral replication per se did not appear to have an overt pathogenetic affect, rather a T-cell...

Ngày tải lên: 14/08/2014, 19:22

... at maximum cooling load of the refrigerator are analytically calculated It is found that the heat leakage and the heat flow via the kinetic energy change have great influences on the performance ... maximum COP ε max can attain the Carnot value ε C 4.2 COP at maximum cooling load The efficiency at maximum power (for a heat engine), or the COP at maximum cooling load (for a refrigerator), is ... the analyses of thermal Brownian motors, the thermodynamics performance is an important factor which has been analyzed by many authors [1, 12-15] And the central issues as to the thermodynamics...

Ngày tải lên: 09/09/2015, 10:17

... chapter by employing a simple mathematical language The governing equations (including strong and weak formulation) and domain discretization are also discussed In addition, advantages and disadvantages ... failure of brittle materials, justifying singular behavior of analytical stress around the crack tip A modified form of the Griffith’s approach for the linear elastic fracture mechanics was later ... newly formed crack surface After calculating the amount of balanced energy U of cracked body and solving dU / da  (a stands for the crack length), he obtained the critical crack size ac as ac ...

Ngày tải lên: 09/09/2015, 18:57

... Hamilton type gradient estimate for a nonlinear diffusion equation on smooth metric measure spaces, Manuscript [5] R S Hamilton, A matrix Harnack estimate for the heat equation, Comm Anal Geom., ... applications are given in section In particular, we show a Harnak type inequality for the general heat equation and a Liouville type theorem for a nonlinear elliptic equation Our results generalizes a work ... studied gradient estimate of Li-Yau type, gradient estimate of Hamilton type for the general heat equation ut = ∆V u + au log u on compact Riemannian manifolds (M, g) In this paper, let (M, g) be a...

Ngày tải lên: 12/10/2015, 16:29

... balanced As stated in Granger (1995), an equation will be called balanced if the major properties of the endogenous variable are available amongst the right-hand side explanatory variables and ... classi…cations are not su¢ cient to handle several situations 2.3 Multivariate Implications This lack of a proper de…nition for non -linear univariate time series translates to multivariate relationships ... balanced Unbalanced equations are related to the familiar problems of spurious relations and misspeci…cation, which are greatly enhanced when managing non -linear functions of variables having a persistency...

Ngày tải lên: 14/11/2015, 07:33

Ngày tải lên: 08/08/2012, 17:20

Ngày tải lên: 04/10/2012, 10:02