data structures and algorithms in c tutorials

... social, economic, and ethical challenges we face in our business Among the issues we are addressing are carbon impact, paper specifications and procurement, ethical conduct within our business and ... shown in the following example const int Cat = 1; int main() { const int Cat = 2; cout

Ngày tải lên: 19/03/2014, 14:08

Ngày tải lên: 12/08/2014, 16:20

Ngày tải lên: 12/08/2014, 16:20

Ngày tải lên: 12/08/2014, 16:20

Ngày tải lên: 12/08/2014, 16:21

Ngày tải lên: 12/08/2014, 16:21

... sequential and binary searches Two classic data structures are examined in Chapter 5: the stack and the queue The emphasis in this chapter is on the practical use of these data structures in solving ... objects in C# The class includes a large set of methods for performing standard operations on strings, such as concatenation, returning substrings, inserting characters, removing characters, and ... better choice than an array In this chapter, we’ll quickly touch on the basics of using arrays in C# , then move on to more advanced topics, including copying, cloning, testing for equality and using...

Ngày tải lên: 22/12/2013, 10:16

... engineering is concerned with the life cycle of a software project, which includes specification, design, verification, coding, testing, production, and maintenance It’s not clear that mixing ... involved yourself in a large project Data structures and algorithms, on the other hand, are nuts -and- bolts disciplines concerned with the details of coding and data storage Accordingly we focus ... Conventions Used in This Book PART I INTRODUCING DATA STRUCTURES HOUR OVERVIEW OF DATA STRUCTURES AND AND ALGORITHMS ALGORITHMS 11 Some Uses for Data Structures and Algorithms...

Ngày tải lên: 17/04/2014, 09:15

... efficient data structures has long been recognized as a vital subject in computing and is part of the core curriculum of computer science and computer engineering undergraduate degrees Data Structures ... mathematical facts, including elementary probability, in Appendix B Relation to Computer Science Curriculum To assist instructors in designing a course in the context of the IEEE/ACM 2013 Computing Curriculum, ... face in our business Among the issues we are addressing are carbon impact, paper specifications and procurement, ethical conduct within our business and among our vendors, and community and charitable...

Ngày tải lên: 24/04/2014, 15:03

... difference involves a concept known as constructor chaining, which is a topic discussed in Section 2.2.3 and is not critical at this point The second difference between a constructor body and that ... experience in the classroom For example, Dr Goodrich has taught data structures and algorithms courses, including Data Structures as a freshman-sophomore level course and Introduction to Algorithms ... object is a specific combination of data and the methods that can process and communicate that data Classes define the types for objects; hence, objects are sometimes referred to as instances...

Ngày tải lên: 28/04/2014, 15:41

... constructors utilize the refinement type of overriding, a scheme called constructor chaining Namely, a constructor begins its execution by calling a constructor of the superclass This call can be ... abstract class lies between an interface and a complete concrete class Like an interface, an abstract class may not be instantiated, that is, no object can be created from an abstract class A subclass ... statement of a constructor C ′ calls another constructor C ″ of the same class using the this reference, the superclass constructor is not implicitly called for C Note that a superclass constructor will...

Ngày tải lên: 14/08/2014, 01:21

... kth Fibonacci number using binary recursion 200 Unfortunately, in spite of the Fibonacci definition looking like a binary recursion, using this technique is inefficient in this case In fact, it ... Since each recursive call to LinearFibonacci decreases the argument k by 1, the original call LinearFibonacci(k) results in a series of k − additional calls That is, computing the kth Fibonacci ... draw the markings of a typical English ruler A ruler is broken up into 1-inch intervals, and each interval consists of a set of ticks placed at intervals of 1/2 inch, 1/4 inch, and so on As the...

Ngày tải lên: 14/08/2014, 01:21

... to it in no time at all Of his four cows, Mazie can cross the bridge in minutes, Daisy can cross it in minutes, Crazy can cross it in 10 minutes, and Lazy can cross it in 20 minutes Of course, ... Problem In the children's game "hot potato," a group of n children sit in a circle passing an object, called the "potato," around the circle The potato begins with a starting child in the circle, and ... class In any case, we show a Deque interface in Code Fragment 5.17 and an implementation of this interface in Code Fragment 5.18 Code Fragment 5.17: Interface Deque documented with comments in...

Ngày tải lên: 14/08/2014, 01:21

... corresponds to the book itself We could, in fact, consider expanding the tree further to show paragraphs consisting of sentences, sentences consisting of words, and words consisting of characters ... Binary Tree interface (Continues in Code Fragment 7.18.) 407 408 Code Fragment 7.18: Portions of the Linked Binary Tree class, which implements the Binary Tree interface (Continues in Code Fragment ... application using an array list instead of a list Compare it experimentally to the list-based implementation Chapter Notes The concept of viewing data structures as collections (and other principles...

Ngày tải lên: 14/08/2014, 01:21

... BinarySearchTree (Continues in Code Fragment 10.4.) 593 594 Code Fragment 10.4: Class BinarySearchTree (Continues in Code Fragment 10.5.) 595 596 Code Fragment 10.5: Class BinarySearchTree (Continued ... worst-case O(n) 9.4 Skip Lists An interesting data structure for efficiently realizing the dictionary ADT is the skip list This data structure makes random choices in arranging the entries in such ... place 577 C- 9.8 Given a collection C of n cost-performance pairs (c, p), describe an algorithm for finding the maxima pairs of C in O(n logn) time C- 9.9 The quadratic probing strategy has a clustering...

Ngày tải lên: 14/08/2014, 01:21

... performance is O(1) per level, broken into a down phase, which typically involves searching, and an up phase, which typically involves recolorings and performing local trinode restructurings (rotations) ... red-black tree achieves logarithmic worst-case running times for both searching and updating in a dictionary The red-black tree data structure is slightly more complicated than its corresponding ... Quick-Select 531 11.8 Exercises 532 java.datastructures.net 11.1 Merge-Sort In this section, we present a sorting technique, called merge-sort, which can be described in a simple and compact...

Ngày tải lên: 14/08/2014, 01:22

... string "cgtacgttcgt ac" R-12.8 Draw a standard trie for the following set of strings: {abab,baba, ccccc,bbaaaa, caa,bbaacc,cbcc,cbca} R-12.9 Draw a compressed trie for the set of strings given in ... Processing At the heart of algorithms for processing text are methods for dealing with character strings Character strings can come from a wide variety of sources, including scientific, linguistic, ... linguistic, and Internet applications Indeed, the following are examples of such strings: P = "CGTAAACTGCTTTAATCAAACGC" S = "http://java.datastructures.net" The first string, P, comes from DNA applications,...

Ngày tải lên: 14/08/2014, 01:22

... containing v and letting V contain the rest of the vertices in V This clearly defines a disjoint partitioning of the vertices of V and, more importantly, since we are extracting edges from Q in order ... topological ordering for Since is acyclic, must have a vertex with no incoming edges (that is, with in- degree 0) Let v be such a vertex Indeed, if v did not exist, then in tracing a directed path ... graph is not dense and is represented using an adjacency list structure 13.4.3 Directed Acyclic Graphs Directed graphs without directed cycles are encountered in many applications Such a digraph is...

Ngày tải lên: 14/08/2014, 01:22