... Ministry of Health, Republic of Uganda; 2003 Kamya MR, Mayanja-Kizza H, Kambugu A, Bakeera-Kitaka S, Semitala F, Mwebaze-Songa P, Castelnuovo B, Schaefer P, Spacek LA, Gasasira AF, Katabira E, Colebunders ... database, validating the quality of data capture of OIs in the research cohort database Discussion In a large HIV observational clinic database of patients receiving ART in Uganda, we found an ... average, about 15 research cohort patients were seen daily by two trained study physicians, and data were entered into a separate research cohort database by a dedicated research clerical team...
Ngày tải lên: 20/06/2014, 08:20
... of data analysis Figure shows an example of dialogue data recorded during a WOZ session On analyzing collected utterances made by the subjects (1,268 utterances in total), it was found that 83% ... from 19 channels It also enables the presentation of program in- Internet Digital broadcasting TV program database Individual profile management program Program retrieval Profile search Dialog processing ... IFR has been given the appearance of a stuffed animal One advantage of this IFR is that it can be directly touched and manipulated to create a feeling of warmth and closeness On hearing a greeting...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... the data analysis as suggested by the data itself and the underlying science For example, while we used a statistical test to quantify peaks in the melanoma study, we could have defined peaks based ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo y học: " The cross-sectional GRAS sample: A comprehensive phenotypical data collection of schizophrenic patients" pptx
... association studies [22-25] Disadvantages may be that the CATIE data were collected by different examiners in 57 US sites and that comprehensive data for phenotypical analyses are only available ... potential of phenotypical readouts derived from the GRAS data collection and their internal consistency; (3) to provide a first panel of epidemiological data as a ‘side harvest’ of this data base; and ... given as well as - for comparison - available normative data of healthy individuals Since for dotting and tapping [39], no normative data were available in the literature, the values shown in Table...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: " Collection by trained pediatricians or parents of mid-turbinate nasal flocked swabs for the detection of influenza viruses in childhood" doc
... antisense CAAAGCGTCTACGCTGCAGTCC, probe fam-TTTGTGTTCACGCTC ACC GTGCC-bhq1; influenza B, sense GAGACACAATTGCCTACCTGCTT, antisense TTCTTTCCCACCGA ACCAAC, probe tet-AGAAGATGGAGAAGG CAAAG CAGAACTAGC-eclipse; ... CGGGTGCCTTTTACAAGAAC, antisense TTCTTTCCTCA ACCTCG TCC, probe vic-ATGCAAGGGCCAATTCTTCCAAG TT-bhq1 Influenza A and B RNA were quantified relatively; the criterion for a positive reaction was a cycle ... There was no refusal to participate, all of the children had two swabs taken (one by the pediatrician and one by a parent), and a satisfaction scale was completed for each As soon as they were delivered...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf
... 1.55 × 10-6 -10 GCGCGCGC RTAAAYAA* 18 391 11 6.52 × 10 14 7.70 × 10-12 1.65 × 10-9 1.68 × 10-12 WWWTTTGCTCR* 15 17 4.15 × 10-1 4.09 × 10-1 AAAAAAAAAAAAAAAAAAAAAAAA TAWWWWTAGM* YCCNYTNRRCCGN* GCGCNNNNNNGCGC ... “homogeneous”) of a selection of known TFs (marked with a star) as well as arbitrary candidate patterns Several known TFs appear to be highly significant (e.g., TF AAGAAAAA with a P-value of 1.31 ... http://www.almob.org/content/5/1/15 Page 14 of 18 Table P-values for several DNA patterns (known transcription factors are marked with a star) in the upstream region data set DNA pattern n CGCACCC* 28 AAGAAAAA*...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo y học: "Comparison between data obtained through real-time data capture by SMS and a retrospective telephone interview" ppsx
... clear about what they are being asked to record, and comfortable with what the researcher plans to with the data [1] SMS - a novel method to collect data Recently, an alternative method of data ... questions are quickly answered and returned compared with frequent mail-outs of questionnaires with stamped envelopes, because the data are automatically transferred to an electronic data file that can ... to achieve a reasonable response rate, respondents may misunderstand or fail to respond to individual questions, and the data must be entered into an electronic data file before analysis can take...
Ngày tải lên: 13/08/2014, 14:20
A COMPRESSED DATA COLLECTION SYSTEMFOR USE IN WIRELESS SENSOR NETWORKS
... and backs the data up to a database In this framework, the data management systems database is the primary backup while the gateways database is a secondary backup in case the management system ... preliminary processing necessary, storing the data to a local database, and forwarding the data to the data management system or application via the Internet It should be noted here that complex data ... diverse sampling rates, because of the different physical variables and mote locations in a WSN largescale deployment When several sensors data flows of a mote are grouped into a data stream, data packets...
Ngày tải lên: 24/08/2014, 12:25
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15] Moreover, invagination ... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of ... Lawson HH Haemoperitoneum associated with a solitary diverticulum of the sigmoid colon S Afr Med J 1961;35:715-6 Matsagas MI, Fatouros M, Koulouras B, Giannoukas AD Incidence, complications, and...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"
... demonstrated that CKBM is able to inhibit cell proliferation in human gastric cancer cell line, AGS The data from a subcutaneous implantation model of gastric cancer tissue was also agreeable to ... Introduction Pharmaceutical research of traditional Chinese medicines on cancer prevention and treatment has attracted much attention There are a number of herbs that have shown to have the abilities ... cell line (AGS) before and after CKBM treatment using Western blot analysis Materials and Methods Cell culture Human gastric cancer cell line (AGS) was obtained from American Type Culture Collection...
Ngày tải lên: 02/11/2012, 11:12
BC su dung TEMS investiongation data collection
... liệu bao gồm Cellfile, Site Name, đồ số vùng cần đo kiểm a Cellfile Load Để Load Cellfile cho TEMS thao tác sau: Từ giao diện Configuration, kích đúp vào phần General, tiếp tục chọn Cellfile Load ... C/I Drop, điều đồng ngh a với việc có mặt nhiễu sóng mang Hình vẽ bên mô tả vị trí bị nhiễu thông qua c a sổ Line chart Radio parameters Hình 3.2 Phát nhiễu qua Line chart Nhiễu nguyên nhân làm ... chèn Site Name sau: Từ Tab GSM hình 2.2, kích trái chuột vào biểu tượng Add Site Name Hình 2.3 Chèn Site Name c Mở đồ , thực Từ Tab GSM, kích chuột vào biểu tượng file đồ (Mapfiles) , sau chọn đến...
Ngày tải lên: 29/08/2013, 13:44
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation
... COMPRESSED AIR INFLUENT AIR SLUDGE WASTE Fig Schematic Diagram of the Coupling of Activated Sludge Process and Membrane Separation MATERIALS AND METHODS Wastewater preparation The wastewater was obtained ... microorganism ratio (F/M ratio), sludge wastage rate, and sludge settling characteristic in sedimentation tank An increase in biomass concentration will increase degradation rate and reduce the area ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost...
Ngày tải lên: 05/09/2013, 09:08
DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions
... of metabolically active bacteria in activated sludge, Microbial Environ., 19, 61- 70 [15] American Public Health Association, American Water Works Association and Water Environmental Federation, ... (2005) Standard method for examination of water and wastewater, 21st ed [16] Japanese Standards Association (1998) Japanese Industrial Standards, JIS K0102 [17] Tarre, S., Beliavski, M., Denekamp, ... with a mesh- filtration unit instead of a membrane) was able to maintain biomass at a very high concentration In this process, stable filtration performance was obtained by intermittent filtration...
Ngày tải lên: 05/09/2013, 09:38
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
... et al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in ... total bacterial count using the standard plate counting method One ml of appropriate dilutions of samples was inoculated in standard plate count agar (Nihon Pharmaceutical Co., Ltd., Tokyo, Japan) ... β-glucuronidase and α-glucosidase, were completely inactivated by the SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated...
Ngày tải lên: 05/09/2013, 09:38
Divided by a Common Language
... Spanish place names and their American pronunciations: Lajolla, in California El Cajon, in California La Quinta, in California St Augustine, in Florida [la hoy -a] [el ca-hone] [la-keen-ta] [saint ... Kflannelis a washcloth • A cot means a crib • A communicating door is a connecting door • Tariffmeans rate Additionally, in Britain a faucet is called a tap, a twin bed is called a single bed, and ... English language—United States—Glossaries, vocabularies, etc English language—Variation—Great Britain—Handbooks, manuals, etc English language—Variation—United States—Handbooks, manuals, etc...
Ngày tải lên: 08/12/2013, 11:59
Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx
... separated urine as mineral fertilizer Poster Bonn University, Germany Vietnam National program on Clean water and Rural sanitation (2002) Objectives of national strategies on clean water and ... governments and rural development staff; Very scare information and documents (books, guidebooks, manuals, ) Awareness the uncontrolled and libertine sanitation situation in rural area was a population ... special in rural areas Urine may lead a bad smell if having a careless treatment Urine fertilizer production organization is not easy to persuade farmers, commercial investors and local government...
Ngày tải lên: 16/01/2014, 17:20
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
... Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... page Listing 5.30 wfrmHowTo5_ 8a. aspx.vb: Filling and Binding the Products to the DataGrid Object Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load ... First Page of This How-To Object Property OleDbDataAdapter ID Setting odaProducts SelectCommand SELECT ProductID, ProductName FROM Products DataSet ID dsProducts DataGrid dgProducts DataSource...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Limit the Data Displayed in a Bound List Box doc
... OleDBDataAdapter1, which was created by using the ? in the Select statement of the data adapter Then Dataset1 is cleared of its data with the Clear method Finally, DataSet1 is refilled with data ... Me.OleDbDataAdapter1.Fill(Me.DataSet1) End Sub Note There is one big difference here between an OleDbDataAdapter and a SqlDataAdapter Whereas the OleDbDataAdapter takes a ? to specify a parameter within the Select statement, ... sender As System.Object, _ ByVal e As System.EventArgs) Handles btnLoadList.Click Me.OleDbDataAdapter1.SelectCommand.Parameters(0).Value = _ Me.txtCustLimit.Text Me.DataSet1.Clear() Me.OleDbDataAdapter1.Fill(Me.DataSet1)...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Getting Started with Oracle Data Integrator 11g: A Hands-On Tutorial pptx
... analysis, data architecture, data modeling, data migration and integration, ETL, data quality, data cleansing, business intelligence, database administration, data mining, and enterprise data warehousing ... 10 years He began his career as a Database Application Programmer and quickly developed a passion for the SQL language, data processing, and analysis He entered the realm of BI and data warehousing ... view of the information is to consolidate the data whether it is in a data warehouse, a series of data marts, or by normalizing the data across applications with master data management (MDM) solutions...
Ngày tải lên: 12/02/2014, 12:20