cytomegalovirus diseases after hematopoietic stem cell transplantation a minireview

... V, Khan SP: Use of prophylactic anticoagulation and the risk of hepatic venoocclusive disease in patients undergoing hematopoietic stem cell transplantation: a systematic review and meta-analysis ... mg four times daily was added to the antibiotic regimen Apart from voriconazole, no medication associated with microangiopathia was administered On day after transplantation, the patient developed ... times a day, escalated up to 800 mg four times a day on day 13) and 80IU unfractionated heparin/kg/day on day There was no other causal treatment Despite early treatment, multiple organ failure...

Ngày tải lên: 11/08/2014, 17:21

... lymphoma (8%) Hodgkin disease (4%) Age at ATG treatment, years Mean (minimum, maximum) Statistical analysis The plasma concentrations of biochemical markers are reported as mean ± standard deviation ... before hematopoietic stem cell transplantation triggered a marked increase in both procalcitonin (PCT) and C-reactive protein (CRP) with a peak at 24 hours after administration, followed by a steady ... demographic data and patients' characteristics are presented in Table A significant increase in PCT was observed starting 24 hours after ATG administration The initial surge was followed by a slow...

Ngày tải lên: 13/08/2014, 16:20

... served as the negative control DNA extraction Total DNA from distinct cell populations was extracted using the QIAamp DNA Blood Mini Kit (Qiagen, Germany) The quality of DNA was analyzed in 1% agarose ... counts after an initial drop to undetectable levels, starting 2-3 months after HSCT and reaching a plateau months after HSCT, indicating ongoing thymic output Although fludarabine-based, non-myeloablative ... curing treatment for refractory hematopoietic malignancies and is often the only available treatment for acute leukemia The transplantation procedure/conditioning regimen generally leads to a prolonged...

Ngày tải lên: 10/08/2014, 21:23

... blasts after transplantation and the donor’s cells, supporting full engraftment of the stem cell transplant as well as the donor cell- origin of the AML blasts Figure Bone marrow smear after allo-SCT ... patient alleles before transplantation; Lane = digestion pattern from patient alleles from AML cell DNA after transplantation; Lane = digestion pattern from donor cell alleles post-SCT hematopoietic ... DNA from mononuclear cells of the patient pre-transplant, of the AML blast cell sample obtained after transplantation, and of the donor bone marrow cells The 11 tested microsatellite markers are...

Ngày tải lên: 10/08/2014, 21:23

... Myelodysplastic syndrome Relapsed AML Hematological malignancy ALL Malignant and nonmalignant disease Malignant and nonmalignant disease Acute leukemia Pretransplant Disease 904 days years 1361 days ... 2.5-12 Age Range of Patients (years) Hematological malignancy Malignant and nonmalignant disease β Thalassemia major Leukemia or myelodysplastic syndrome Malignant and nonmalignant disease ALL Myelodysplastic ... after peripheral blood stem cell transplantation than bone marrow transplantation Acute GVHD, malignant disease, recipient age (>10 years), and a female donor to male recipient were significant...

Ngày tải lên: 12/02/2014, 19:20

... feasibility and transplant-related mortality Autoimmune Disease and Lymphoma Working Parties of the European Group for Blood and Marrow Transplantation, the European League Against Rheumatism and the ... disease by hematopoietic stem cell transplantation: getting closer to a cure? Blood 2002, 99:870-887 Traynor AE, Barr WG, Rosa RM, Rodriquez J, Oyama Y, Baker S, Brush M, Burt RK: Hematopoietic stem ... None declared References 10 11 12 13 14 Marmont AM, van Lint MT, Gualandi F, Bacigalupo A: Autologous marrow stem cell transplantation for severe systemic lupus erythematosus of long duration Lupus...

Ngày tải lên: 09/08/2014, 01:23

... bioportfolio.com/news/article/23449/Karmanos-Cancer-Institute-ResearchersCollaborators-Study-Possible-Link-Between-Childhood-Leukemia-Gilbert html] Pidala J, Kim J, Anasetti C, Kharfan-Dabaja MA, Field T, ... in the diagnosis and treatment of GS [8,9] List of abbreviations GS: Gilbert’s syndrome; allo-HSCT: Allogeneic hematopoietic stem cell transplantation; AML: acute myeloid leukemia; CR: complete ... and bilirubin levels were almost normal during the conditioning and within 100 days after transplantation, although indirect hyperbilirubinemia repeatedly happened during chemotherapy with daunorubicin,...

Ngày tải lên: 10/08/2014, 21:23

... Kappa staining of BAL ment as a complication of relapsed disease after autologous stem cell transplantation The presence of circulating plasma cells and hyperammonemia are both known to be indicators ... T, Akioka T, Miyamoto H, Oka S, Hara S, Yamano T, Takasu T, Tsuji M, Hanafusa T: Pulmonary parenchymal infiltrates in a patient with CD20-positive multiple myeloma European Journal of Haematology ... myeloma: antemortem diagnosis International Journal of Hematology 2006, 83:259-261 Gambichler T, Othlinghaus N, Stucker M, Altmeyer P, AKCaE : Dermatology Cutaneous giant plasmacytoma associated...

Ngày tải lên: 10/08/2014, 22:20

... journal Abbreviations aGVHD: acute graft-versus-host disease; AML: acute myelogenous leukemia; ANA: anti-nuclear antibodies; ANCA: anti-nuclear cytoplasmic antibodies; cGVHD: chronic graft-versus-host ... the hematology unit and the renal unit, acquisition of data, analysis and interpretation of data, review of the literature, and drafting and revising the manuscript All authors read and approved ... C4, rheumatoid factor, anti-mitochondrial antibodies and anti-nuclear cytoplasmic antibodies (ANCA) were all normal A direct Coomb’s test was negative, anti-nuclear antibodies (ANA) were positive...

Ngày tải lên: 11/08/2014, 02:21

... et al.: Autologous stem cell transplantation for systemic lupus erythematosus Lupus 2004, 13:168-176 Saccardi R, Kozak T, Bocelli-Tyndall C, Fassas A, Kazis A, Havrdova E, Carreras E, Saiz A, ... Czechowicz A, Kraft D, Weissman IL, Bhattacharya D: Efficient transplantation via antibody-based clearance of hematopoietic stem cell niches Science 2007, 318:1296-1299 Ogawa M, Matsuzaki Y, Nishikawa ... reactivation after autologous stem cell transplantation Acta Haematol 2008, 119:22-27 55 Peggs KS: Reconstitution of adaptive and innate immunity following allogeneic hematopoietic stem cell transplantation...

Ngày tải lên: 09/08/2014, 10:23

... lavage Diagn Microbiol Infect Dis 2005, 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori ... Marty FM, Schwartz RB: MR imaging of human herpesvirus-6-associated encephalitis in patients with anterograde amnesia after allogeneic hematopoietic stem- cell transplantation AJNR Am J Neuroradiol ... reviewed and published immediately upon acceptance Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic stem cell...

Ngày tải lên: 12/08/2014, 04:21

... lavage Diagn Microbiol Infect Dis 2005, 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori ... Marty FM, Schwartz RB: MR imaging of human herpesvirus-6-associated encephalitis in patients with anterograde amnesia after allogeneic hematopoietic stem- cell transplantation AJNR Am J Neuroradiol ... reviewed and published immediately upon acceptance Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic stem cell...

Ngày tải lên: 12/08/2014, 04:22

... Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Chapter The Advanced HLA Typing Strategies for Hematopoietic Stem Cell Transplantation 45 Sun Yuying and ... consequently a more accurate assessment of transplant-related complications Author details Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Immunogenetics Laboratory, ... Hematopoietic Stem Cell Transplantation Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Additional information is available at the end of the chapter http://dx.doi.org/10.5772/54281...

Ngày tải lên: 18/02/2014, 04:20

... rabbit, cat (named Copycat) and monkey In 2006, reprogrammed murine iPSCs were reported by Takahashi and Yamanaka (Takahashi and Yamanaka, 2006) and in 2007 human iPSCs were reported (Takahashi ... of Hematopoietic Stem Cell Transplantation (HSCT) 517 Ami J Shah, Tena Rosser and Fariba Goodarzian Chapter 26 Adenoviral Infection – Common Complication Following Hematopoietic Stem Cell Transplantation ... Hematopoietic Stem Cell Transplantation for Adult Acute Lymphoblastic Leukaemia 267 Pier Paolo Piccaluga, Stefania Paolini, Francesca Bonifazi, Giuseppe Bandini, Giuseppe Visani and Sebastian Giebel Chapter...

Ngày tải lên: 20/02/2014, 08:20

... 5’GATGAGTTTGGACAAACCAC3' YMT2 PCR primers: ymt1 5’CTGGAGCTCTACAGTGATGA3' ymt2 5’CAGTTACCAATCAACACATCAC3' Myogenin PCR primers: myo1 5’TTACGTCCATCGTGGACAGC3' myo2 5’TGGGCTGGGTGTTAGTCTTA3' 10 Deoxynucleotide ... marrow-repopulating ability Proc Natl Acad Sci USA 92, 8901–8905 Osawa, M., Hanada, K.-I., Hamada, H., and Nakauchi, H (1996) Long-term lymphohematopoietic reconstitution by a single CD34–low/negative hematopoietic ... Bone Marrow Most of the antibodies described in this protocol are available from Pharmingen (San Diego, CA), and hybridomas are readily available from a number of laboratories Lineage-marker antibodies:...

Ngày tải lên: 11/04/2014, 09:45