cyclosporine a and tacrolimus fk506

... of action may take place in the breast causing breast hypertrophy and fibroadenomata, which could explain the breast changes in our patient Both cyclosporine- A and feldipine (a calcium antagonist) ... test, chest X-ray and echocardiogram showed no abnormalities Serum prolactin level was also within normal range Bilateral breast and axillary ultrasound examination supported the clinical findings ... doi:10.1186/1752-1947-4-267 Cite this article as: Darwish et al.: Cyclosporine- A therapy-induced multiple bilateral breast and accessory axillary breast fibroadenomas: a case report Journal of Medical Case Reports 2010...

Ngày tải lên: 11/08/2014, 03:21

... of action may take place in the breast causing breast hypertrophy and fibroadenomata, which could explain the breast changes in our patient Both cyclosporine- A and feldipine (a calcium antagonist) ... test, chest X-ray and echocardiogram showed no abnormalities Serum prolactin level was also within normal range Bilateral breast and axillary ultrasound examination supported the clinical findings ... doi:10.1186/1752-1947-4-267 Cite this article as: Darwish et al.: Cyclosporine- A therapy-induced multiple bilateral breast and accessory axillary breast fibroadenomas: a case report Journal of Medical Case Reports 2010...

Ngày tải lên: 11/08/2014, 07:20

... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... countries a Sun b always c on d in > a 52 The man that wife and family are away seems very lonely a that b and c are d seems > a 53 Each year more and more people try setting new and unusual records ... has been demand for computers this year than last year a few b little c fewer d more > d 290 Always make sure your luggage has on it when you travel a a card b a cartel c a label d a traveling-bag...

Ngày tải lên: 05/11/2012, 09:18

... climbing, backpacking, and adventure tourism Some recreational activities are made illegal such as gambling and drug use Research has shown that recreation contributes to life satisfaction, quality ... life, health and wellness, and that the use of recreation as a diversion may have clinical applications to individuals with chronic pain and other health impairments In some cultures and religions, ... Holiday is also a common time for recreation Traditionally, music and dance serve as recreation in many cultures Playing sports, hobbies, games and tourism are popular forms of recreation Watching...

Ngày tải lên: 02/07/2013, 01:25

... TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; ... 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: ... AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining for NF-jBp65 MSCs in IMDM supplemented with 10% fetal...

Ngày tải lên: 18/02/2014, 04:20

... FEBS G Vaaje-Kolstad et al L lactis chitinase and chitin-binding protein A B Fig Sequence alignments for LlChi1 8A and LlCBP3 3A (A) Catalytic domains of LlChi1 8A (chitinase of L lactis ssp lactis), ... initial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts synergistically with LlChi1 8A However, the effect of LlCBP3 3A was small and ceased after approximately ... containing a putative transcription regulator (GenBank ID: AAK06047.1), chitinase gene (GenBank ID: AAK06048.1) and gene encoding a family 33 CBP (GenBank ID: AAK06049.1) was amplied FEBS Journal...

Ngày tải lên: 18/02/2014, 08:20

... b1,3galactosidases, giving rise to a disaccharide and a monosaccharide, and was thus identified as a mixture of Galb1-4[Fuca1-3]GlcNAcb1-3Gal and Galb1-3[Fuca1-4]GlcNAcb1-3Gal The calculated amounts ... b1,4galactosidases, giving rise to a disaccharide and a monosaccharide, and is thus identified as a mixture of Galb1-3GlcNAcb1-3Gal and Galb1-4GlcNAcb1-3Gal The tetrasaccharide is sensitive to a1 ,3/4 ... large O-glycans contain a minimal amount of radioactivity and were not analysed further, whereas those released from T5AS clone mostly show a disaccharide peak and a smaller trisaccharide peak...

Ngày tải lên: 19/02/2014, 12:20

... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and respiratory ratio in intact cells Respiratory parameters and...

Ngày tải lên: 06/03/2014, 09:22

... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... FnBRA lacking FnBPA-9 and FnBPA-10 (A, C) Recombinant, His-tagged full-length FnBRA and FnBRA lacking FnBPA-9 and FnBPA-10 (FnBRAD9,10) were immobilized on microtiter wells (1 lg in 100 lL) and ... Injection began at s and ended at 180 s Table Affinity parameters for NTD–FnBR interactions The parameters were determined by SPR measurements, with immobilized FnBRs of FnBPA and FnBPB as ligands and...

Ngày tải lên: 06/03/2014, 22:21

... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed ... (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b-domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA and MDPNCSCSTGGSCTCT ... a high-resolution solution structure of the C-terminal a- domain has become available The data revealed a tertiary fold very similar to that of MT-1 and MT-2, except for a loop that contains an...

Ngày tải lên: 07/03/2014, 09:20

... channels, and in particular with data obtained with b-PTH showing the formation of cationselective ion channels in artificial lipid bilayer membranes and in the plasmalemma of rat hippocampal ... PTH-containing and PIN-containing crude fractions were dialyzed against deionized water and freeze-dried, and a1 -PTH, a2 -PTH and b-PTH were separated (at room temperature) by semipreparative RP-HPLC ... extracellular Ca2+ concentration on the effect of a1 -PTH (B and C) Note that in (A) only a1 -PTH produces membrane depolarization, and in (B) and (C) increasing extracellular Ca2+ concentration...

Ngày tải lên: 07/03/2014, 12:20

... rebinding are shown in Figs and The transient absorption decays were analyzed using a standard least-squares technique using homemade software for PC After kinetic normalization, analysis showed that ... the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found to exceed 2.2 ± 0.3- and 3.1 ... dissociation rate constant at an insignificant change in the association rate constant (Fig 4, D2 and D1, respectively) Also, at pH 8.5, the rebinding study reveals an increase in the association and...

Ngày tải lên: 16/03/2014, 14:20

... PCR was carried out for 25 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C, using two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGAGAA CAAC-3¢ and 5¢-CCGCTCGAGTCAACCTCCCGTCT G-3¢ The DNA products ... model at 1.2 A, with one exception ˚ between Asp16 and Arg36, which is seen in the 1.6 A model The amino acids are shaded in red, green and blue for acidic, neutral and basic polar residues, and ... corresponding amino acids for different surface charges on SUMO-2 and SUMO-1 are shown Positively charged, negative charged and neutral polar residues are coloured blue, red and magenta, respectively, and...

Ngày tải lên: 16/03/2014, 18:20

... cPLA2 -a and convert arachidonic acid into prostaglandin H2 [8,9] To date, two distinct COX isoforms, COX-1 and COX-2, have been identified and characterized, and an alternative splice variant ... extracellular calcium Cells were then fixed and permeabilized and incubated with goat polyclonal anti-cPLA2 -a serum and mouse monoclonal antibodies against annexin V, annexin I, p11, caveolin, actin ... with goat polyclonal anti-cPLA2 -a and rabbit polyclonal anti-calreticulin sera, followed by donkey FITC-conjugated anti-sheep and donkey Texas Red-conjugated anti-rabbit sera Cells were visualized...

Ngày tải lên: 16/03/2014, 18:20

... ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place • Above ... • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and sequencing ... and the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A magnetic field filters all DNA rich beads from empty beads, and then extracts...

Ngày tải lên: 19/03/2014, 22:32

... flax leaves Galactolipids were separated and purified as described in Materials and methods EDE content was measured by UV absorbance of MGDG and DGDG fractions at 267 nm Average values and standard ... galactolipid molecular species from flax leaves Total galactolipids were extracted from flax leaves, separated and purified as described in Materials and methods UV chromatograms (267 nm) of galactolipids ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A and B, two new oxylipins from Arabidopsis thaliana Tetrahedron...

Ngày tải lên: 23/03/2014, 05:22

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...

Ngày tải lên: 23/03/2014, 07:20

... and potassium alkali metal and various di- and tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A) In addition, the alkali metal adducts ... masslynx version 4.1 (Waters Corporation) With standard solvents, a capillary voltage of 3000 V and a cone voltage of 45 V was used With neutral solvents, a capillary voltage of 3500 V and a ... and a corresponding amino acid sequence AVSAPTATPASPAGKKTVR All three N-terminal peptides were acetylated at the N-terminal amino acid, and the signal intensity decreased with lower molecular masses...

Ngày tải lên: 30/03/2014, 02:20

... from fa ⁄ fa than Fa ⁄ ? rats and also that there is a rightward shift in the plots of glycogen synthesis against phosphorylase -a or glycogen synthase against phosphorylase -a in fa ⁄ fa compared ... kit (Amersham Pharmacia Biotech, Piscataway, NJ) Statistical analysis Results are expressed as means ± SE Statistical analysis was carried out using the Student’s t-test (either paired or unpaired) ... (C) Phosphorylase immunoreactivity (arbitary densitometry units) and representative immunoblot of fa ⁄ fa (n) and Fa ⁄ ? (h) preparations Data are mean ± SE for n ¼ (A) , n ¼ 15 (B) and n ¼ (C),...

Ngày tải lên: 30/03/2014, 11:20

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was ... (K45 5A) (lane 5), and AGD ⁄ AGE (R24 6A ⁄ K45 5A) (lane 6) were expressed in E coli and autoactivated at acidic pH [34] Activated samples were analyzed by SDS ⁄ PAGE, and native cardosin A (CA) was ... recombinant wild type cardosin A (CAwt) (positive control); lane 2, CA mutant RGA (D24 8A) ; lane 3, CA mutant AGD (R24 6A) ; lane 4, CA mutant KGA (E45 7A) ; lane 5, CA mutant AGE (K45 5A) ; lane 6, CA double...

Ngày tải lên: 30/03/2014, 11:20