cyanobacteria—isolation purification and identification

... Structures and molecular weights of soyasapogenol B, C and B1 98 Fig 28 LC-MS Chromatogram of standard and purified sample of soyasapogenol B Panels (A and C) are authentic standard and samples ... recovery of soyasapogenols A and B without producing artifacts (Ireland and Dziedzic 1986; Rupasinghe, Jackson et al 2003) Moreover, Ireland and Dziedzic (Ireland and Dziedzic 1986) showed that ... confounding authentic saponin identification and quantification The purification process is complex and laborious with long sample preparation and extraction times and yielding relatively low amounts...

Ngày tải lên: 11/09/2015, 10:06

... 16S-9F and 16S-1525R The result of PCR perform size band of strains and Bacillus subtilis control had 1500bp Sequencing perform that strains (Bs4 and BN5) were Bacillus subtilis (99% and 98% ... environment and organic matter should be decided on the subject of Bacillus subtilis isolated from waste water of beer and beer wallows in the brewing process Objective: Isolation, selection and identification ... Alisi, C And Tasso, F and published on Modern multidisciplinary applied microbiology journal, in Italia (2006) +Bacillus subtilis strain E9-1was identified in “Isolation, identification, and characterrization...

Ngày tải lên: 06/10/2015, 12:58

... primers (D and E) and the first-strand cDNA for 3¢ RACE as the template As a result, the 527-bp PCR product was specifically amplified To obtain the 3¢ and 5¢ terminal segments of the cDNA, 3¢ and 5¢ ... detected strongly in kidney, brain, liver and ocular fluid, and weakly in skeletal muscle and spleen of Nile tilapia The mRNA expression in the brain and kidney obtained in this study are therefore ... carnosinase-like (assembled using TC33189, CX353277 and TC29012), anserinase-like (assembled using CK873786 and TC31285) and CNDP-like (assembled using CK884742, CX352802 and TC22931); ascidian Ciona intestinalis,...

Ngày tải lên: 19/02/2014, 07:20

... P010726-22, P010726-23, P010726-25, and O157-C-1-2), and 14 USA isolates; strains of ATCC (A1, A2, A3, and A4), strains of Cornell University (C1, C2, C3, C4, C5, and C6), and strains of Pennsylvania ... eaeA, and hlyA in multiplex PCR assay, (iii) to compare the genetic patterns of Korean isolates and U.S isolates, and (iv) to compare the efficiency among conventional culture method, IMS, and ... were collected from pigs and cattle at slaughterhouses, and from chicken at meat processing plants The sponge sampling method was used to collect 286 pork and beef samples and homogenization was...

Ngày tải lên: 07/08/2014, 18:21

... giant pandas’ spleens, infected and non-infected FCWF cells (as positive and negative controls) using the TRizol Reagents kit (Invitrogen, USA) per the manufacturer’s recommendations o and the ... Bacteriology failed to grow organisms in cultures inoculated with liver and spleen after 48 h culture Fig Isolation and culture of giant panda virus (GPV) in Felis catus whole fetus (FCWF) cell line (A) ... was amplified from tissues and infected FCWF cells, while PCR for non-infected FCWF cells yielded no results By sequencing and analysis, the sequences from tissues and infected FCWF cells showed...

Ngày tải lên: 07/08/2014, 23:22

... fractionated the dichloromethane extract and yielded three diterpene compounds, namely andrographolide, 14-deoxyandrographolide and 14-deoxy-11,12-didehydroandrographolide Andrographolide showed the greatest ... powder mixture of andrographolide plus 14-deoxyandrographolide and 14-deoxy-11,12-didehydroandrographolide together The mixture stimulated phagocytosis, and elevated antibody titer and plaque-forming ... of the nhexane and methanol extracts of A paniculata Seven compounds, namely andrographolide, bis-andrographolide 14-deoxy-11,12-didehydroandrographolide, andrograpanin, 14-deoxyandrographolide,...

Ngày tải lên: 13/08/2014, 15:21

... continuous encouragement, wise advice and kind support Her support, understanding, advice and mentoring have helped guide me through my doctoral program and my dissertation Without her, none ... Molecular and Cell Biology, who helped me process the tissue immunohistological staining I would like to thank Dr Chan Lai Wah and Dr Go Mei Lin for their valuable guidelines on my Ph.D candidature and ... acid and thus initiates the formation of free radicals via the cyclo-oxygenase and lipoxygenase pathways (Handlogten et al., 2001) Increased level of free radicals disrupts redox homeostasis and...

Ngày tải lên: 11/09/2015, 10:06

... of the standard The symbols and designations in this standard can depict both hardware and function Sketches and technical papers will usually contain highly simplified symbolism and identification ... preface, footnotes, and appendices is included for information only and is not a part of the standard The instrumentation symbolism and identification techniques described in the standard accommodate ... instructions, and knowledge about measurement and control systems in the process industries This document is a consensus standard rather than a mandatory one As such, it has many of the strengths and the...

Ngày tải lên: 04/04/2013, 12:40

... 3′ for the sense strand and 5′-GAG GAG AAG CCC GGT-insert specific sequence 3′ for the antisense strand (Table 6.1) Position X in the sense primer must complete the codon and therefore will encode ... sequences are slightly different and are represented as attB1 and attB2 that recombine with the attP1 and attP2 sites respectively on the donor vector, creating attL1 and attL2 sites when BP clonase ... loaded onto the spin column, which is washed to remove dNTPs and primers, and the PCR products are eluted The procedure is rapid (~15 min) and results in highly purified DNA for use in ligation reactions...

Ngày tải lên: 25/10/2013, 22:20

... Physics 24 (2008) 209-222 identification, dynamic response and so on Several literatures presented the POD’s application to decompose the spatially-correlated and multi-variate random pressure fields ... troublesome and difficulties in interpreting theses results In this paper, the POD based spectral and covariance matrices of the random field will be presented Both covariance-based and spectral-based ... orthogonal basic vectors which can expand a multi-variate random process into a sum of products of these basic orthogonal vectors and single-variant uncorrelated random processes Let consider the...

Ngày tải lên: 05/03/2014, 14:20

... GLUT1 and GLUT3 (exons 3–8), and four in human GLUT2 (exons 7–10) and GLUT4 (exons 6–9) (Table 1) The codons for arginine (96) and valine (231) in gcGLUT (Fig 2) are split between exons and 5, and ... (between exon and exon 5) and valine (between exons and exon 7) are shown Exonic regions are shown in uppercase and intronic regions are in lowercase The split codons are boxed and highlighted ... 2-phenoxyethanol (0.05% v/v) for min, and killed by a blow to the head Tissues were then dissected out and snap-frozen in liquid nitrogen, and stored at )80 °C Animal care and experiments were conducted...

Ngày tải lên: 17/03/2014, 03:20

... ml of saline (for virus control and cell control) and given ml 2x MEM The cells were incubated for 72 hours and observed for cytopathic effects from the virus and cytotoxic effects from the samples ... Dr Tran Ngoc Ninh, Vietnamese Academy of Science and Technology Extraction and isolation Leaves of Clausena heptaphylla were dried at 40 ÷ 500C and powdered The powder (500 g) was extracted with ... MeOH 900 at 800C The extract was filtered and concentrated in vacuo to yield 84 g extract The concentrated extract was fractionated into Hexan, EtOAc, BuOH, and H2O-soluble fractions, sequentially...

Ngày tải lên: 03/04/2014, 15:20

... microbes and against desiccation;  formation of a thick bark in roots and stems against water loss, microbes, and herbivores;  development of spines, thorns, hooks, trichomes, and glandular and ... structure determination and biosynthetic studies), analytical chemists, and synthetic organic chemists Toxicologists, pharmacologists and pharmaceutical companies have used and will certainly continue ... [against bacteria], peroxidase, and phenolase, lectins, protease inhibitors, toxalbumins, and other animal-toxic peptides), polysaccharides, and polyterpenes More diverse and more prominent are low...

Ngày tải lên: 04/06/2014, 15:25

... detection and identification based on random multiplex (RT)-PCR using 3'-locked random primers to avoid primer-dimer amplification Once detected, virus amplification products can be shot-gun cloned and ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus ... 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified...

Ngày tải lên: 18/06/2014, 18:20

... SDS and Triton X100 can greatly interfere with HPLC and mass spectrometric analysis [8] We tested the efficiency of OG in separating the virion components and found that the supernatant and pellet ... proteins (E6R and L3L) has not been described previously The peptides detected for each of these proteins are listed in Tables and The E6R ORF is situated between the E5R and E7R genes and produces ... E11L, G1L, G7L, H1L and J1R – all of which were identified in our analysis We also found membrane proteins (F9L, F10L, and E8R) and cytosolic proteins (A16L, E10R, F8L, G4L, and I3L) The remaining...

Ngày tải lên: 19/06/2014, 08:20

... detection and identification based on random multiplex (RT)-PCR using 3'-locked random primers to avoid primer-dimer amplification Once detected, virus amplification products can be shot-gun cloned and ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus ... 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified...

Ngày tải lên: 20/06/2014, 01:20

... SDS and Triton X100 can greatly interfere with HPLC and mass spectrometric analysis [8] We tested the efficiency of OG in separating the virion components and found that the supernatant and pellet ... proteins (E6R and L3L) has not been described previously The peptides detected for each of these proteins are listed in Tables and The E6R ORF is situated between the E5R and E7R genes and produces ... E11L, G1L, G7L, H1L and J1R – all of which were identified in our analysis We also found membrane proteins (F9L, F10L, and E8R) and cytosolic proteins (A16L, E10R, F8L, G4L, and I3L) The remaining...

Ngày tải lên: 20/06/2014, 04:20

... conducted the RT-PCR and western blot ananlysis and was assisted in these experiments by JAB and JAAG MM and CR helped in designing appropriate Muc16 primers JC assisted in obtaining and maintaining ... Identification of soluble Muc16 and MUC16 by Western blotIdentification of soluble Muc16 and MUC16 by Western blotting Purified MUC16 (25 μg total protein/lane) from MOVCAR-2 (lane 1) and OVCAR-3 cells (lane ... human and murine forms of the mucin MUC16 is both expressed on the cell surface and shed from the cell in soluble forms Muc16, on the other hand, is detected primarily in the spent media and in...

Ngày tải lên: 20/06/2014, 07:20

... sequencing of our FIII-3a and FIII-3b proteins Generally, the two-step chromatography of AEX and HIC was sufficient for the purification of FIII-1, FIII-2, and FII, since their SEC and SDS-PAGE profiles ... from MS/MS analyses of FIII-1 and FIII-2 from P excavatus with lumbrokinase and its precursor from L rubellus (sp:P83298 and U25647) and E fetida (gpu:EU167737 and AY438624), with a serine protease ... minutes and was lyophilized A series of chromatographic techniques were used for purification Fractions containing proteases were collected and analyzed by SDS-PAGE (Hames 1998) after each purification...

Ngày tải lên: 20/06/2014, 23:20