... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... private void UpdateDataFromDifferentDataSourceForm_Load(object sender, System.EventArgs e) { // Create the DataAdapter for the source records daSource = new SqlDataAdapter("SELECT * FROM Customers",...
Ngày tải lên: 21/01/2014, 11:20
... 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse) The pET151 HP1287 plasmid was amplified using PfuTurbo DNA polymerase and incubated with DpnI to digest the template plasmid Mutated ... QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo y học: "Different properties of ACPA and IgM-RF derived from a large dataset: further evidence of two distinct autoantibody systems" potx
... Nishimura K, Sugiyama D, Kogata Y, Tsuji G, Nakazawa T, Kawano S, Saigo K, Morinobu A, Koshiba M, Kuntz KM, Kamae I, Kumagai S: Meta-analysis: diagnostic accuracy of anti-cyclic citrullinated peptide ... between changes in ACPA or IgM-RF and markers of inflammation Discussion Characteristics of ACPA and IgM-RF were studied in a large group of RA and non-RA patients ACPA status was more stable than IgM-RF ... arthritis Ann Rheum Dis 2009, 68:201-208 Matsui T, Shimada K, Ozawa N, Hayakawa H, Hagiwara F, Nakayama H, Sugii S, Ozawa Y, Tohma S: Diagnostic utility of anti-cyclic citrullinated peptide antibodies...
Ngày tải lên: 09/08/2014, 14:21
Báo cáo y học: " Application of different measures of skeletal maturity in initiating weaning from a brace for scoliosis: two case reports" docx
... because it takes into account the fact that the bones of the hand and wrist not necessarily mature at the same rate, and instead of having to make a judgement call as to the best ‘atlas match,’ ... decrease in peak expiratory flow, total lung capacity, vital capacity, and functional residual capacity [8] Curves >40–50 degrees may cause cor pulmonale Page of (page number not for citation ... secondary to reduced chest wall compliance Chest wall compliance and vital capacity are inversely correlated with Cobb angles >10 degrees As Cobb angle and apical rotation increase, there is a decrease...
Ngày tải lên: 11/08/2014, 17:21
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt
... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protein band, individual gamma gliadin peptides obtained from ... sequences from the bacterium Methanosarcina mazei, and the resulting database was interrogated with the original spectral data using the same search engines Peptide identifications were accepted...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: " Peripheral blood B lymphocytes derived from patients with idiopathic pulmonary arterial hypertension express a different RNA pattern compared with healthy controls: a cross sectional study" pdf
... to compare differential expression profiles between groups (e.g healthy vs diseased) The raw data from array scans were averaged across all gene probes on each array by MAS5 and RMA, two different ... screening Leuk Lymphoma 2007, 48(5):978-986 Hatanaka H, Takada S, Choi YL, Fujiwara S, Soda M, Enomoto M, Kurashina K, Watanabe H, Yamashita Y, Sugano K, Mano H: Transforming activity of purinergic ... different mathematical algorithms to process, background-correct and normalize raw data from microarray gene chips, thereafter, a scaling factor was applied to bring the average intensity for all probes...
Ngày tải lên: 12/08/2014, 15:21
How to setup a Linux system that can boot directly from a software RAID
... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... Minor RaidDevice State removed active sync /dev/hda1 Replacing the failed disk When a new disk to replace the failed one is available it can be installed into the system, partitioned to have the ... [root@fedora4 giotex]# mdadm manage /dev/md0 add /dev/hdc1 mdadm: hot added /dev/hdc1 [root@fedora4 giotex]# mdadm manage /dev/md1 add /dev/hdc2 mdadm: hot added /dev/hdc2 [giotex@fedora4 ~]$ cat...
Ngày tải lên: 18/09/2012, 10:11
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf
... stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another over time The Japanese have ... She added another value: that many women care about social issues and will patronize a company that cares.19 Greg Carpenter and Kent Nakamoto have challenged a core assumption of marketers that ... notion that a company wins by building a relevant and sustainable competitive advantage.17 Having a competitive advantage is like having a gun in a knife fight This is true, but today most advantages...
Ngày tải lên: 21/09/2012, 17:33
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... premises Medical wastes include injurious medical wastes and common wastes Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... houses are non-standard, unsanitary and highly infectious In some areas, medical wastes are urgent matters because there have been no places for wastes to be gathered even in provincial hospital...
Ngày tải lên: 23/09/2012, 15:38
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying...
Ngày tải lên: 03/11/2012, 11:44
A visit from a pen pal
... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... atmosphere over the party was warm and friendly (Không khí b a tiệc đầm ấm thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover (Tất cầu nguyện cho cô mau...
Ngày tải lên: 17/01/2013, 09:58
English Proverbs from A to Z
... appearances E Early to bed and early to rise makes a man healthy, wealthy and wise Easier said than done What is suggested sounds easy but it is more difficult to actually it Empty vessels make ... time Good management is better than good income Great minds think alike Great oaks grow from little acorns Large successful operations can begin in a small way H Half a loaf is better than none ... the atmosphere is clear, frost may form Clothes don't make the man Appearances can be deceiving Constant occupation prevents temptation When you work you avoid temptation D Dead men tell no tales...
Ngày tải lên: 18/06/2013, 01:26
Unit 1: A visit from a pen pal
... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...
Ngày tải lên: 21/06/2013, 01:27
Unit 1: A visit from a pen pal
... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... visited * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will ... wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I...
Ngày tải lên: 21/06/2013, 01:27
Unit 1_ A visit from a penpal
... Date: Name: _ English 9_ Unit Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light ... Communist north, and (REUNIFICATE) _occurred in mid-1975 Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding over two years ago Lan & her pen-pal, Maryam have ... Democratic Republic of Vietnam (North Vietnam) and the former Republic of Vietnam (South Vietnam) Education in Vietnam is universal and _ for children ages to 11 The _language of...
Ngày tải lên: 26/06/2013, 01:27
Techical analysis from a to z
... technical analysis thirty years ago, many people considered technical analysis just another 1960's adventure into the occult Today, technical analysis is accepted as a viable analytical approach ... technical analysis thirty years ago, many people considered technical analysis just another 1960's adventure into the occult Today, technical analysis is accepted as a viable analytical approach ... money managers and home managers, students and strikers, doctors and dog catchers, lawyers and landscapers, and the wealthy and the wanting This breadth of market participants guarantees an element...
Ngày tải lên: 13/08/2013, 15:59
Marketing insights from a to z 80 concepts every manager needs to know
... stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another over time The Japanese have ... She added another value: that many women care about social issues and will patronize a company that cares.19 Greg Carpenter and Kent Nakamoto have challenged a core assumption of marketers that ... notion that a company wins by building a relevant and sustainable competitive advantage.17 Having a competitive advantage is like having a gun in a knife fight This is true, but today most advantages...
Ngày tải lên: 15/08/2013, 14:09
Evaluation of Nutrient Loads from a Citrus Orchard in Japan
... station by Japan Meteorological Agency (2008) Load Estimations Load evaluation of Case was calculated by water discharge and nutrient load from our only weekly research data (Table 1) In the Case ... (Cases and 4) by applying the least-squares method to antilogarithmic and logarithmic regression curves The Case evaluation was made on an antilogarithm scale, and Case used a logarithmic scale ... water discharge was almost same as the base flow We therefore need a way of accurately quantifying nutrient load from farmland during rainfall events We can obtain sequential nutrient load data...
Ngày tải lên: 05/09/2013, 10:15
Nutrient Loss from a Tea Plantation Area in Japan
... stable As a result, the annual discharge of nitrogen and phosphorus from the tea plantation area were estimated to be 535kgN/ha/year and 21kgP/ha/year, respectively, indicating that the tea plantation ... tea plantation area, fertilizer was mainly applied in two seasons, which are early spring during February and March for basal fertilization and summer during August and September for additional ... Agricultural Center, 26, 34-41 (in Japanese) Matsuo H., Baba Y., Nakamura Y., Tokunaga T., Kitamori S., Hirata T and Nishikawa M (2000) The changes of nitrogen flux for decreasing of the annual amount...
Ngày tải lên: 05/09/2013, 10:15