... of NBS encoding disease resistance genes The QTL cp4.1 was mapped within a cluster of candidate genes, while cp4.2 mapped between two candidate genes QTL cp6 was located close to the anchor marker ... candidate genes on the map of cultivated peanut can be inferred Marker names in Medicago are BAC clone identification codes Genetic distances in Arachis are in cM, and in Medicago in Mbp of DNA Candidate ... populations Genomics 1987, 1(2):174-181 Moraes SA, Salgado CL: Utilizaỗóo da tộcnica de folhas destacadas de amendoim (Arachis hypogaea L.) para inoculaỗừes com Cercospora arachidicola Hori e Cercospora...
Ngày tải lên: 12/08/2014, 03:21
... nucleus and the cytoplasm [29] The association of speci c transcripts with such factors in the nuclear compartment might thus condition their cytoplasmic fate Altogether, our results and previous ... synthetic double-stranded polyriboinosinic polyribocitydylic acid Fig Schematic representation of the DNA constructs (poly rI.rC) and was observed in other cell types such as Namalwa B cells (data not ... The PIFNCRIDHA and PIFNCRIDHAAU– constructs described in Fig 2, were transfected in Hec-1B cells The cells were infected with the Sendaı¨ virus for h and were harvested (lanes 1, 2, and 6) and h...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
... Motif name Motif sequence Relative competition B G8A G 8C C3A C3 G A 2C G1T G1A G 1C CON A2G x 200 C Motif name Motif sequence G11A G11T G1 1C C10T C1 0G G 9T G 9C CON x 200 particularly important for ... six3b Co n B -T AA TG a1 TC -T AA TG br AC C -T G AT br G AC -T C G AT ns A AC -T G G AT ns AC T A -T G AT AC T LP-Con LP-a1 Fig Influence of surrounding DNA sequences and comparison with other recognition ... primer and 5¢-CTGTGTGGAATTCATACGTCG CATTC-3¢ as reverse primer, cloned in-frame into the BamHI and EcoRI site of the pGEX-2T expression vector (Pharmacia Biotech Inc., Uppsala, Sweden), and transformed...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt
... http://www.virologyj.com/content/3/1/4 CH1 CH22 CH2 CH5 CH14 BI-5 C9 54 C1 24 E428 11 Towne C9 49 CH6 NW23-2 C1 917 CH8 C9 52 14 C2 21 CH15 E759 13 C9 56 12 CH20 C3 22 CH23 E460 E763 CH18 CH25 CH19 Toledo CH21 E760 ... Portland specimens for the same region were 5'-GCTTAAGCCAATCGCAGCGAGC-3' and 5'-GTC GCCTCGGTAGCTCAGTAGC-3' The amplification protocols were the same as described above for the UL146UL147 products ... L1 X162 C1 18 C9 54 C C C D+R+ urine urine urine 55 55 55 16 C1 C1 C1 C6 9 C1 72 Y Y D+R- urine urine 21 21 C1 C1 CH1-A CH1-B CH1 CH1 D+R- BAL BAL 1.1 years 4.5 years >10 CH1-1 CH1-1 CH2-A CH2 D+R-...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " The complete genome sequence of a Crimean-Congo Hemorrhagic Fever virus isolated from an endemic region in Kosovo" pot
... from China to the Middle East and Southern Russia and to the focal endemic areas in Africa and southern Europe, including Kosovo and Turkey [2] Yearly epidemics, as well as sporadic cases of CCHF ... Kosovo in particular, is a wellknown endemic region for CCHF, and epidemic outbreaks and sporadic cases have been frequently been recorded [6-8] Five nucleotide sequences of CCHFV from Kosovo ... for Crimean Congo hemorrhagic fever virus glycoprotein localization and transport Virology 2007, 361:348-355 24 25 26 Sanchez AJ, Vincent MJ, Erickson BR, Nichol ST: Crimean-congo hemorrhagic fever...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: " ZINBA integrates local covariates with DNA-seq data to identify broad and narrow regions of enrichment, even within amplified genomic region" doc
... positive and negative relationship with the background and enriched components, respectively (c, d) Receiver operating characteristic (ROC) curves for the performance of three different componentspecific ... Biology, Carolina Center for Genome Sciences, and Lineberger Comprehensive Cancer Center, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 3Department of Genetics and School ... the local background estimate, G /C content, and mappability score as starting covariates, we found ZINBA was able to correctly classify background regions within CNVs (Figure 4b) and called and...
Ngày tải lên: 09/08/2014, 23:20
báo cáo khoa học: " Sequence diversity in three tomato species: SNPs, markers, and molecular evolution" pptx
... of 58 C, which decreased 0.5 C per cycle for 15 cycles and stayed constant at 55 C for 30 cycles Extension time was 40 seconds and denaturizing steps were performed for 30 seconds at 96 C PCR products ... interspecific analysis, LxH: S lycopersicum and S habrochaites interspecific analysis L: S lycopersicum intraspecific analysis "Position" indicates the nucleotide position in the unigene sequence ... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived...
Ngày tải lên: 12/08/2014, 03:20
Genetic variability in tomato germplasm (solanum lycopersicum l ) using morphological characteristics and simple sequence repeat (SSR) markers
... GAGAGGTGCCACATCACCTT (R) 20 GTCCCTACCCCACAAATTGAA (F) 21 AGGTACAACTCACCTCCCCC (R) 20 GTGAAGACGAAAAACAAGACGA(F) 22 CCTTCCCCTTTTGTCTCTCC (R) 20 GTGAAGACGAAAAACAAGACGA (F) 22 CCTTCCCCTTTTGTCTCTCC (F) 20 TCTTTCAACTTCTCAACTTTGGC ... TCTTTCAACTTCTCAACTTTGGC (F) 23 GCCGACTTCAAAAACTGCTC (R) 20 GCATTGATTGAACTTCATTCTCGTCC (F) 26 ATTTTTGTCCACCAACTAACCG (R) 22 ATTGTAATGGTGATGCTCTTCC (F) 22 CAGTTACTACCAAAAATAGTCAAACAC(R) 27 ATTTCTGTAACTCCTTGTTTC ... CAGTTACTACCAAAAATAGTCAAACAC(R) 27 ATTTCTGTAACTCCTTGTTTC (F) 20 TGACTTCAACCCGACCCCTCTT (R) 22 TAACACATGAACATTAGTTTGA (F) 22 CACGTAAAATAAAGAAGGAAT (R) 21 TCCAACACCCCCTACACCAT (F) 20 TAACACGTCCACACAAGGAC (R) 20 F= Forward...
Ngày tải lên: 18/03/2016, 22:51
International Capital Flows and Boom-Bust Cycles in the Asia Pacific Region +
... represent such shocks by plotting cumulative capital flow shocks for each country and relating them to economic events occurred Figure plots identified cumulative capital account shocks in each country.22 ... the current account imbalances are often financed by capital account, and we would like to exclude such endogenous movements of capital flows from the shocks to capital flows Second, we condition ... the effects of capital flows on co-movements of business cycles Financial market integration can increase business cycle comovements as macroeconomic effects of capital flows in different countries...
Ngày tải lên: 24/10/2012, 09:27
Báo cáo y học: "Iraqi health system in kurdistan region: medical professionals’ perspectives on challenges and priorities for improvement"
... tested and subjected to three cycles of modifications based on iterative feedback received from ten medical professionals in clinical practice The questionnaire was directly dispatched to the selected ... important role and power in adopting and running health-care systems Therefore, their views on efficiency of such system and needs for any changes are very critical and constitute a cornerstone ... the excess in specialist physicians and insufficient physicians focusing on the primary health care or family practice [4] While insufficiency in nurses and other health staff is well documented...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"
... atherosclerosis [10,11] Apart from atherosclerotic lesions, cerebral ischaemic damage may also cause increased radical production and expression of ICAM-1 and MCP-1, or be associated with increased ... to decrease No statistically significant change was observed concerning MMP-9 and ICAM-1 The outcome of the PCA of the radical data, data concerning the degree of arteriosclerotic disease and ... I and RP OXANO levels at baseline, clamp and reperfusion respectively MCP11, MCP15, MCP19; MCP levels before, during and after clamping, ICAM11, ICAM15, ICAM19; ICAM levels before, during and...
Ngày tải lên: 26/10/2012, 10:03
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... Table Characteristics of study participants Biochemical analysis Plasma total cholesterol concentrations, as well as serum creatinine and uric acid concentrations, were measured using standard ... oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic ... natriuretic peptide concentration: impact of age and gender J Am Coll Cardiol 2002; 40: 976-82 19 Maffei S, Del Ry S, Prontera C, Clerico A Increase in circulating levels of cardiac natriuretic peptides...
Ngày tải lên: 26/10/2012, 10:04
A study on evidential modal markers in english
... hẳn là, chắn show that the speaker is almost certain of what is stated (34) Surely that is a plain-clothes policeman = Ch c cảnh sát m c thờng ph c = Ch c chắn c nh sát m c thờng ph c (35) Surely ... semantics and pragmatics In typological research, the most common type of hierarchy are implicational universals which are used to predict possible and impossible language systems as well as directions ... (Rheme) can pass the exam (Rheme) I am sure 1.5 BACKGROUND ON SPEECH ACT THEORY 1.5.1 SPEECH ACT THEORY This section offers a brief introduction to the basic speech act theoretic concepts developed...
Ngày tải lên: 07/11/2012, 14:54
Food, Animal production and Human Comsumption in the Asian Region
... (Chicken, Duck & Turkey) Pig and small ruminant (Pigs, Goat & Sheep) Large ruminants ( Cattle, Buffalo) A: Economic: Serve as a current bank account, sale for small B: Social: Fighting, fancy ... animals cash for daily needs A: Economic: Serve as semi annual account, sale for Payments such as books, clothing, school fees B: Social: Religious ceremonies A: Serve as long term account sale ... Rice bran, broken rice Left over grains, left over foods, weeds Rice bran, broken rice Crop stems, crop wastes Weeds, marginal land Rice straw, corn stalk Other crop wastes trees, marginal land...
Ngày tải lên: 08/04/2013, 10:35
some renewable energy sources in the ASEAN region
... hydro-electric schemes has gained prominence since the early twentieth century and such schemes have continued to become larger The USA alone currently has over 2,000 hydroelectric power plants which ... natural landscape: Power lines are alien substances in nature and can ruin natural landscapes They can affect the bird population, either through collision or by short circuit due to contact Conversely, ... emissions (like Carbon dioxide and other gases) caused by electricity production in coal, oil, or gas fired power plants b Encroachment on Nature: The environmental consequences of the construction...
Ngày tải lên: 25/04/2013, 08:20
Sự hòa hợp giữa các thì (Sequence of tenses)
... teaching l you can/ it is necessary Activity 3: Look at the following pictures and make sentences with the given situations Free Practice: Make three sentences of your own, using Adverbial Clauses ... will stay here until you come back while I’m having my lunch until you have finished your coffee Controlled Practice: Do the exercise (p 137) a begins e have read i reached / was following/ was/ ... (join) a club 30 p.m tomorrow the day after I (arrive) Alice and I (wait) at the Activity 2: Complete each of the following sentences with an adverbial clause of time (p 139) had recovered from...
Ngày tải lên: 09/06/2013, 01:26
KHAI THÁC D. LI.U ESTs (EXPRESSED SEQUENCE TAGs) . CHI CAM CHANH (CITRUS) CHO VI.C PHÁT TRI.N MARKER PHÂN T. SSR (SIMPLE SEQUENCE REPEATS)
... sequence GGCTCAAGTACTTATTTTTTAATATAGTGCACTCGAAGCTAGCAAATATC TTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAGCG ATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATGAT GTTGGGAATGACAATCTTGATCTTATCGTTATTCCTCAATATGGGAGAA ... TTGTTACAGTAGCAATTTTGACTCACTCTTAAGTCTTTGCTGTTGTATTGATATCAACTG TTATTGACGACTTTTAATAGTGCATTTCCATGATTTTGTCTATTAACTTGTCAATAAAAGTAAAGA ATTCCTGTATTGCAAAATTACTTT[TATATATATATA]GAGGGGTTATGCGGTCTGGGATCCCAGA CTGTAATTAAAGTCCAGGATTGGGACCATGTGTAGCAGATTAATAAATAAATAAATAAATCCAACG ... TTGTTACAGTAGCAATTTTGACTCACTCTTAAGTCTTTGCTGTTGTATTG ATATCAACTGTTATTGACGACTTTTAATAGTGCATTTCCATGATTTTGTC TATTAACTTGTCAATAAAAGTAAAGAATTCCTGTATTGCAAAATTACTTT [TATATATATATA]GAGGGGTTATGCGGTCTGGGATCCCAGACTGTAATT...
Ngày tải lên: 03/09/2013, 10:00
Sequence và Index
... sequence cho giá trị sau tăng phải x c định tên sequence trư c currval nextval sequence.CURRVAL sequence.NEXTVAL Để truy c p sequence không thu c schema thời, phải tên schema schema.sequence.CURRVAL ... integer] [CYCLE/NO CYCLE]; Với: INCREMENT BY START WITH MAXVALUE MINVALUE CYCLE/NO CYCLE Chỉ Chỉ Giá Giá Dãy M c định khoảng c ch định số trị lớn dãy trị nhỏ dãy c quay vòng định NO CYCLE dãy số dãy ... Sequence Sequence danh sách số, tạo Oracle sever Sequence dùng để tạo khóa c ch tự động cho lệu Sequence thường dùng để tạo khóa sinh mã tự động C thể dùng chung cho nhiều đối tượng Con số sequence...
Ngày tải lên: 29/09/2013, 05:20
SEQUENCE VÀ INDEX
... Trong mệnh đề SET c u lệnh UPDATE Không sử dụng CURRVAL NEXTVAL trường hợp sau Trong c u hỏi Trong view snapshot Trong c u lệnh SELECT c t c tử DISTINCT Trong c u lệnh SELECT c sử dụng GROUP ... CHECK 9.1.2 Thay đổi huỷ sequence Thay đổi sequence: ALTER SEQUENCE sequence_name INCREMENT BY integer START WITH integer [MAXVALUE integer] [MINVALUE integer] [CYCLE/NO CYCLE]; Huỷ sequence: ... SEQUENCE sequence_name ; 9.2.INDEX 9.2.1 Tạo index Index c u tr c sở liệu, sever sử dụng để tìm row bảng c ch nhanh chóng Index bao gồm key value (một c t (column) hàng (row)) ROWID C pháp: CREATE...
Ngày tải lên: 29/09/2013, 05:20