0

cross tabulations between the potential predictors and outcome at 3 months

Báo cáo y học:

Báo cáo y học: "he Nordic Subpopulation Research Programme: prediction of treatment outcome in patients with low back pain treated by chiropractors - does the psychological profile matter" pps

Báo cáo khoa học

... if they had none of these findings to 36 % if they had or of them (Table 7, Table and Table 9) Results at months i Cross- tabulations between the potential predictors and outcome at3 months The ... tissue therapy blocks/SOT Number Percentage 718 13 98 271 460 37 63 16 86 30 3 276 46 12 42 38 262 108 36 0 36 15 49 36 7 36 3 50 50 36 6 161 201 50 22 28 280 286 116 43 39 39 16
  • 13
  • 354
  • 0
Báo cáo y học:

Báo cáo y học: "Correlation between the AKI classification and outcome" pdf

Báo cáo khoa học

... (ESRF) and three patients with incomplete data The remaining 22 ,30 3 patients were included in the study Data analysis The AKI criteria were applied to 22 ,30 3 patients Due to a lack of data on ... room 34 13 18.7 750 18.7 Ward (including HDU) 38 45 21.0 1574 39 .3 Hospital transfers 1894 10.4 531 13. 3 Recovery room 5 43 3.0 62 1.5 Other 42 0.2 16 0.4 32 25 17.6 1,148 28.7 1.88 (1.74 to 2. 03) ... creatinine values 2264 ( 53. 2%) 33 4 (14.8%) with rising creatinine values 439 (51.2%) 157 (35 .8%) with falling creatinine values 418 (48.8%) 65 (15.6%) with rising creatinine values 639 ( 23% ) 31 8...
  • 10
  • 391
  • 0
báo cáo hóa học:

báo cáo hóa học: " Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission time and heart rate" docx

Hóa học - Dầu khí

... in the ρmax between TS-down and TS-up groups at the middle parts of the video, Part-2 and Part -3 This result indicates that the repetition of watching made some subjects more sensitive to the ... difference between the two groups both at Part-2 and Part -3 (t-test, p < 0.05) In addition, between Day1 and Day3, there was a delay in the time when the ρmax of TS- As shown in Fig 2, the subjective ... citation purposes) Journal of NeuroEngineering and Rehabilitation 2007, 4 :35 3b) on both days while that of Subject -3 whose TS were low did not change much (Fig 3c) These results suggest that the...
  • 6
  • 534
  • 0
Tài liệu Mapping Table and Column Names Between the Data Source and DataSet docx

Tài liệu Mapping Table and Column Names Between the Data Source and DataSet docx

Kỹ thuật lập trình

... Table2, and so on You can use table mapping to rename tables created within the DataSet to match the table names in the data source or to map the tables returned from a batch query to DataTable ... property These objects map the name of a table in the data source to a DataTable with different name in the DataSet When a batch query is used to fill multiple tables within a DataSet, the table ... information from a data source Like the Fill( ) method, the Update( ) method always uses mapping information (if present) when submitting DataSet changes back to the data source In the solution, the...
  • 3
  • 445
  • 0
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

Báo cáo khoa học

... the protonated state of the chaperone initiates this cycle, whereas the deprotonated state occurs upon completion of the maturation process of the partner The nature of the signal that may trigger ... )9.6 )2.7 )9 )3. 4 4.4 )6 .3 1.9 7.1 18.2 )20.1 ) 23. 4 )10.6 )11.8 )8.1 ) 13. 8 5.2 )16 )5.6 5 .3 7.1 27 .3 24 36 .8 35 .6 39 .3 33. 6 52.6 31 .4 41.8 52.7 54.5 )1 )9 · 10 3. 1 · 10)7 3. 8 · 10)9 2.9 · 10)7 · ... investigate the kinetic parameters of the interaction (on rate constant kon and off rate constant koff) between NarJ and the NarG(1–15) peptide Taking into account the existence of two subpopulations...
  • 10
  • 685
  • 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo khoa học

... translocated across the membrane to the luminal side and are of low affinity Furthermore, in the E1 conformational state, the ATPase can be phosphorylated by ATP, which drives the translocation ... exciting at 295 nm and detecting the emission at 34 0 nm q FEBS 2001 Inhibition of the Ca2þ-ATPase by curcumin (Eur J Biochem 268) 632 5 been associated with Ca2þ binding to the ATPase [16] At pH 7, the ... for the fits are # 0.7) Curcumin concentration (mM ) Catalytic Km (mM ) Catalytic Vmax (IU·mg21) Regulatory Km (mM ) Regulatory Vmax (IU·mg21) 3. 0 (2.7–6.6) 6 .3 (6 .3 9 .3) 0.40 (3. 8–1.0) 13. 6 ( 13. 4–14.2)...
  • 10
  • 594
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx

Báo cáo khoa học

... head of w3 can be found among the words (wl and w2) syntactically dependent on the word, w3 That is the word, wl Furthermore, the crossing of a2 and a3 violates the non-crossing condition The context ... If the focused word (called FOCUS) and the word on the top of the push-down stack (called Pd-TOP) have the FEATUREs specified by the rule, a new HEAD with the derived FEATUREs is created by the ... bridge the gap between both kinds of dependencies When Legato creates a new HEAD from Pd-TOP and HEAD, the context associated with Pd-TOP is stacked up onto the context stack in the new HEAD At the...
  • 7
  • 373
  • 0
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf

Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf

Báo cáo khoa học

... 5¢-AATTCGGGGCCCGGGTTCTGGATCACTTCGCGCACGCTCTGGAACAGATTCTG -3 5¢-CGGAGCAGCTGCTTAAGCCGGGG -3 5¢-AAGCTTCTGCAGGTCGACTCTAGG -3 5¢-GATCCATATCGATAAGCTTAGATCTGAATTCA -3 5¢-AATTCAGATCTAAGCTTATCGATATG -3 Ó FEBS 2002 ... [20 ,30 ,31 ] To investigate whether like 23FQNLF27, 30 VREVI34 could contribute to N/C interaction, two constructs were generated, expressing either the complete 30 VREVI34 or the complete 23FQNLF27 ... NTD and AR LBD Amino acids 3 36 in the NTD (AR3 )36 ), including the 23 FxxLF27 motif, play a pivotal role in N/C interaction [15,20] Here we studied the function of the AR3 )36 subdomain AR3) 13 in...
  • 12
  • 597
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

Điện - Điện tử

... in the Das G1 primer, 9T1-1, at the 5' end (Fig 2) Due to these mismatches, the Das G1 primer failed to detect most (75%) of the G1 strains Since, the primer set had perfect matches at the 3' ... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3 CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches in the primers ... isolates and became the most prevalent genotype, and the number of untypeable strains was reduced from 36 .9 to 2.1 % The other common G types were G9 (21.7%), G2 (15.0%), and G4 ( 13. 8%) The previous...
  • 5
  • 389
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Hóa học - Dầu khí

... three out of the four mutations by ■, and three mutations plus others at the primer binding site by ᮀ The open branches indicate one or two mutations at the primer binding site The lineages are ... Virology Journal 2006, 3: 35 http://www.virologyj.com/content /3/ 1 /35 recently it was suggested the use of modified or degenerated primers to avoid the mismatches between the primer and the VP7 gene [17,20] ... showing the four lineages described in genotype G1 of rotaviruses The strains having the four mutations reported by Rahman and his colleagues are indicated by ●; the four mutations plus others at the...
  • 4
  • 329
  • 0
báo cáo hóa học:

báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx

Hóa học - Dầu khí

... in the Das G1 primer, 9T1-1, at the 5' end (Fig 2) Due to these mismatches, the Das G1 primer failed to detect most (75%) of the G1 strains Since, the primer set had perfect matches at the 3' ... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3 CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches in the primers ... isolates and became the most prevalent genotype, and the number of untypeable strains was reduced from 36 .9 to 2.1 % The other common G types were G9 (21.7%), G2 (15.0%), and G4 ( 13. 8%) The previous...
  • 5
  • 355
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Nanoliposomes for encapsulation and delivery of the potential antitumoral methyl 6-methoxy-3-(4methoxyphenyl)-1H-indole-2-carboxylate" doc

Hóa học - Dầu khí

... liposomes M-JRPQ and PMF supervised the organic synthesis and compound characterization and participated in the draft of the manuscript LAVS was responsible for the antitumoral evaluation of the compound ... conceived the study, were responsible for the interpretation of results, and drafted the manuscript ASA carried out the liposome preparation, the DLS and zeta potential measurements and dialysis ... across the dialysis membrane and incorporation in the membrane of the acceptor liposomes The phospholipids DPPC and DPPG are the main components of biological membranes and are both in the gel...
  • 6
  • 323
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Representation of Multivariate Functions via the Potential Theory and Applications to Inequalities'''' docx

Báo cáo khoa học

... calculation shows that the right-hand side of 5.14 for fp,y equals the above LHS ii The first identity of 5.15 follows from Theorem 5.1, while the second follows from Theorem 1 .3 with Ω BR a and ... for the absolute value of the difference D f; x : f x − b b−a f t dt, x ∈ a, b 5 .3 a The obtained results have been applied in approximation theory, numerical integration, information theory, and ... dx 3. 11 uf y 3. 12 From Proposition 2.10, we know that lim uf t Ω t→y f y By combining 3. 11 and 3. 12 , we attain 1.10 Proof of (b) Assume that f ∈ C Ω and p ≥ Let y ∈ RN \ Ω be fixed We define the...
  • 15
  • 267
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Representation of Multivariate Functions via the Potential Theory and Applications to Inequalities" ppt

Báo cáo khoa học

... calculation shows that the right-hand side of 5.14 for fp,y equals the above LHS ii The first identity of 5.15 follows from Theorem 5.1, while the second follows from Theorem 1 .3 with Ω BR a and ... for the absolute value of the difference D f; x : f x − b b−a f t dt, x ∈ a, b 5 .3 a The obtained results have been applied in approximation theory, numerical integration, information theory, and ... dx 3. 11 uf y 3. 12 From Proposition 2.10, we know that lim uf t Ω t→y f y By combining 3. 11 and 3. 12 , we attain 1.10 Proof of (b) Assume that f ∈ C Ω and p ≥ Let y ∈ RN \ Ω be fixed We define the...
  • 15
  • 288
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A balancing act between the X chromosome and the autosomes" ppsx

Báo cáo khoa học

... modulate the expression of the X chromosome in the soma and germ cells Further studies to elucidate how each species achieves dosage compensation between the X chromosomes and the autosomes in the ... et al [8] is the fact that the X chromosomes in the Drosophila germline are upregulated to match the expression of the autosomes The molecular mechanism of dosage compensation in these cells is ... related to the use of common pathways between sex determination and dosage compensation in this species Interestingly, the expression of the X chromosome seems to be slightly higher than that...
  • 3
  • 315
  • 0
báo cáo khoa học:

báo cáo khoa học: "Genetic disequilibria between the α β-, κ-casein -, S1 and the β-lactoglobulin loci of the Bavarian Brown and Bavarian Simmental cattle" docx

Báo cáo khoa học

... differentiation between the A’, Nand A alleles at the f3-Cn locus which however did not prevent the recognition of the disequilibria between the f3-Cn and the a,,-Cn loci In our tBV sample the disequilibrium ... represents the disequilibrium between loci i and j and p q the gene , ; j ij r denotes the gametic correlation and N equals the number at the loci of gametes in the sample In our samples the rare ... disequilibria between the (x,,-Cn and the K locus vary between breeds In our Bavarian Braunvieh sample (tabl 3) the linkage disequilibrium was negative between the respective BA alleles at the loci and...
  • 9
  • 300
  • 0
Báo cáo y học:

Báo cáo y học: " The interaction between the PARP10 protein and the NS1 protein of H5N1 AIV and its effect on virus replication" pot

Báo cáo khoa học

... florescent, indicating that NS1 could change the localization of PARP10 (Figure 3b) The localization result in NIH3T3 cells was same to that in A549 cells So the results illustrated that NS1 could ... after the infection, and no significant increase in the supernatant and in the cells afterwards, indicating that H5N1 AIV replication reached the peak in BHK21 cells at 48 h (Figure 6) Therefore, ... buffer (Gibico), ml serum-free medium and 5 × 105 pfu H5N1 AIV were added, and then lightly oscillated to mix up The plate was incubated at 37 °C for h, and then cells were rinsed twice with Hanks...
  • 28
  • 391
  • 0
Báo cáo y học:

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

Báo cáo khoa học

... MSCs The obtained MSCs demonstrated a phenotype that matches the generally accepted phenotype for murine MSCs, being positive for CD 73 and Sca-1 and negative for CD11b, CD31, CD34, CD45, and CD90 ... explanation for the discrepancy between the in vitro and in vivo settings might be that the intravenously injected MSCs not reach the spleen and lymph nodes and are therefore unable to inhibit the ... unstimulated or stimulated MSCs (data not shown) These data indicate that IFN-g acts synergistically with IL-17 to upregulate expression of PD-L1, iNOS, and COX-2 in MSCs, making these molecules candidate...
  • 11
  • 464
  • 0
Báo cáo y học:

Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot

Báo cáo khoa học

... 0.99 0. 63 0. 63 2.60 1 .35 1.17 0.71 0.76 0.92 2 .31 0 .37 25 .33 Upper 3. 79 0.59 0.48 0.91 0.97 0.42 0.41 1.78 0.84 0.79 0.46 0.48 0.57 1.09 0.24 13. 74 1 .32 1.41 0.99 1.01 0. 93 0.98 3. 80 2.19 1. 73 1.10 ... store our data, was in charge of the data collection, and contributed to authoring the manuscript Both authors initiated the study OBN translated the data into SPSS and generated the tables HML ... also facilitate teamwork and interprofessional communication and may therefore increase the success of weaning [8] On the other hand, there are significant barriers to the use of such standardised...
  • 8
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: "Genetic subtraction profiling identifies genes essential for Arabidopsis reproduction and reveals interaction between the female gametophyte and the maternal sporophyte" pot

Báo cáo khoa học

... (At1 g75610, At4 g0 430 0, At2 g 137 50, At3 g32917, At4 g05600, At4 g07780, At2 g 235 00, At1 g7 835 0, At5 g34990, and At2 g10840), but they were omitted as pseudogenes by the The Arabidopsis Information Resource (TAIR) ... Protein-Related 0 At3 g28020 Unknown 0 0 At3 g19780 Unknown 0 0 At5 g30520 Unknown 0 0 At3 g4 538 0 Unknown 0 0 At4 g 237 80 Unknown 0 0 At1 g54926 Unknown 0 0 At3 g 237 20 Unknown 0 0 At1 g47470 Unknown 1, 0 0 At1 g32680 ... of the mature embryo sac was observed for genes AT5 G40260, AT4 G30590, AT5 G60270, and AT4 G01970 (Figure 2) The trithorax group gene ATX3 and AT5 G50915 were predominantly expressed in the egg and...
  • 21
  • 254
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008